Cart 34 Product Products 7 258,12 € (empty)
-
-
-
1 x hCG_181173...113,40 € -
1 x CCNI2-cycl...121,50 € -
1 x CCDC54-coi...121,50 € -
1 x HBD-hemogl...113,40 € -
1 x MKRN3-mako...113,40 € -
-
-
1 x UGCG-UDP-g...121,50 € -
1 x GEMIN7-gem...113,40 € -
1 x TMEM53-tra...121,50 € -
1 x HAT1-histo...121,50 € -
-
-
1 x C14orf100-...121,50 € -
1 x CCDC115-co...113,40 € -
1 x IL17F-inte...113,40 € -
-
-
1 x SERINC1-se...121,50 € -
1 x LDHA-lacta...121,50 € -
1 x ZNF69-zinc...113,40 € -
1 x ROPN1B-rop...113,40 € -
1 x GHRL-ghrel...113,40 € -
1 x SERPINA3-s...121,50 € -
1 x IFT81-intr...121,50 € -
-
-
1 x SERPINB8-s...113,40 € -
1 x GEMIN8-gem...113,40 € -
-
1 x SERPINB9-s...121,50 € -
No products
To be determined Shipping
7 258,12 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 34 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 258,12 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 258,12 €
View larger 
PTPN11-protein tyrosine phosphatase, non-receptor type 11 Gene
PTXBC008692
New product
Data sheet of PTPN11-protein tyrosine phosphatase, non-receptor type 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PTPN11-protein tyrosine phosphatase, non-receptor type 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008692 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PTPN11 |
| Origin species: | Human |
| Product name: | PTPN11-protein tyrosine phosphatase, non-receptor type 11 Gene |
| Size: | 2ug |
| Accessions: | BC008692 |
| Gene id: | 5781 |
| Gene description: | protein tyrosine phosphatase, non-receptor type 11 |
| Synonyms: | BPTP3; CFC; JMML; METCDS; NS1; PTP-1D; PTP2C; SH-PTP2; SH-PTP3; SHP2; tyrosine-protein phosphatase non-receptor type 11; PTP-2C; protein-tyrosine phosphatase 1D; protein-tyrosine phosphatase 2C; protein tyrosine phosphatase, non-receptor type 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacatcgcggagatggtttcacccaaatatcactggtgtggaggcagaaaacctactgttgacaagaggagttgatggcagttttttggcaaggcctagtaaaagtaaccctggagacttcacactttccgttagaagaaatggagctgtcacccacatcaagattcagaacactggtgattactatgacctgtatggaggggagaaatttgccactttggctgagttggtccagtattacatggaacatcacgggcaattaaaagagaagaatggagatgtcattgagcttaaatatcctctgaactgtgcagatcctacctctgaaaggtggtttcatggacatctctctgggaaagaagcagagaaattattaactgaaaaaggaaaacatggtagttttcttgtacgagagagccagagccaccctggagattttgttctttctgtgcgcactggtgatgacaaaggggagagcaatgacggcaagtctaaagtgacccatgttatgattcgctgtcaggaactgaaatacgacgttggtggaggagaacggtttgattctttgacagatcttgtggaacattataagaagaatcctatggtggaaacattgggtacagtactacaactcaagcagccccttaacacgactcgtataaatgctgctgaaatagaaagcagagttcgagaactaagcaaattagctgagaccacagataaagtcaaacaaggcttttgggaagaatttgagacactacaacaacaggagtgcaaacttctctacagccgaaaagagggtcaaaggcaagaaaacaaaaacaaaaatagatataaaaacatcctgccctttgatcataccagggttgtcctacacgatggtgatcccaatgagcctgtttcagattacatcaatgcaaatatcatcatgcctgaatttgaaaccaagtgcaacaattcaaagcccaaaaagagttacattgccacacaaggctgcctgcaaaacacggtgaatgacttttggcggatggtgttccaagaaaactcccgagtgattgtcatgacaacgaaagaagtggagagaggaaagagtaaatgtgtcaaatactggcctgatgagtatgctctaaaagaatatggcgtcatgcgtgttaggaacgtcaaagaaagcgccgctcatgactatacgctaagagaacttaaactttcaaaggttggacaagggaatacggagagaacggtctggcaataccactttcggacctggccggaccacggcgtgcccagcgaccctgggggcgtgctggacttcctggaggaggtgcaccataagcaggagagcatcatggatgcagggccggtcgtggtgcactgcaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - gamma-aminobutyric acid (GABA) A receptor, gamma 1 - CAP, adenylate cyclase-associated protein, 2 (yeast) - gamma-aminobutyric acid (GABA) A receptor, alpha 3 - enhancer of mRNA decapping 3 homolog (S. cerevisiae) |