Cart 68 Product Products 11 584,56 € (empty)
-
1 x SERPINA4-s...121,50 € -
-
1 x BRUNOL5-br...121,50 € -
1 x SERPINA10-...121,50 € -
1 x PMEPA1-pro...113,40 € -
1 x Phospho-HS...259,07 € -
-
-
1 x RNF7-ring...113,40 € -
1 x HBA1-hemog...113,40 € -
1 x PSG1-pregn...121,50 € -
1 x SERP1-stre...113,40 € -
-
-
1 x SERPINA3-s...121,50 € -
1 x OR2C1-olfa...121,50 € -
1 x HHAT-hedge...121,50 € -
-
1 x GCLM-gluta...121,50 € -
-
-
-
-
-
1 x CCDC108-co...113,40 € -
1 x GORASP2-go...121,50 € -
1 x SERPINB12-...121,50 € -
-
-
1 x OGG1-8-oxo...121,50 € -
1 x SERPINI2-s...121,50 € -
1 x ANGPTL4-an...121,50 € -
1 x sVCAM-1494,00 € -
-
1 x HAT1-histo...113,40 € -
1 x KRT8-kerat...121,50 € -
1 x APOBEC3G-a...113,40 € -
-
-
-
1 x IFI44-inte...121,50 € -
1 x GGT1-gamma...113,40 € -
1 x HEATR5A-HE...113,40 € -
1 x Visfatin...694,00 € -
-
1 x IFI44L-int...121,50 € -
1 x SERPINA7-s...121,50 € -
1 x Beclin-1...259,07 € -
-
-
1 x SERINC1-se...121,50 € -
1 x DEDD2-deat...121,50 € -
-
-
1 x HIBCH-3-hy...121,50 € -
1 x TSKU-tsuku...121,50 € -
1 x DEFA5-defe...113,40 € -
-
-
1 x Zymogen...744,00 € -
1 x IFI30-inte...113,40 € -
1 x CCNE2-cycl...121,50 € -
1 x hCG_204271...113,40 € -
-
1 x APBB1IP-am...113,40 € -
1 x ERH-enhanc...113,40 € -
1 x GFRA1-GDNF...121,50 € -
1 x GEMIN6-gem...113,40 €
No products
To be determined Shipping
11 584,56 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 68 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 11 584,56 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 11 584,56 €
Data sheet of CRTAC1-cartilage acidic protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRTAC1-cartilage acidic protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034245 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRTAC1 |
| Origin species: | Human |
| Product name: | CRTAC1-cartilage acidic protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC034245 |
| Gene id: | 55118 |
| Gene description: | cartilage acidic protein 1 |
| Synonyms: | ASPIC; ASPIC1; CEP-68; cartilage acidic protein 1; acidic secreted protein in cartilage; chondrocyte expressed protein 68 kDa CEP-68 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaccctgaggccagtgacctctcccggggcattctggcgctcagagatgtggctgctgaggctggggtcagcaaatatacagggggccgaggcgtcagcgtgggccccatcctcagcagcagtgcctcggatatcttctgcgacaatgagaatgggcctaacttccttttccacaaccggggcgatggcacctttgtggacgctgcggccagtgctggtgtggacgacccccaccagcatgggcgaggtgtcgccctggctgacttcaaccgtgatggcaaagtggacatcgtctatggcaactggaatggcccccaccgcctctatctgcaaatgagcacccatgggaaggtccgcttccgggacatcgcctcacccaagttctccatgccctcccctgtccgcacggtcatcaccgccgactttgacaatgaccaggagctggagatcttcttcaacaacattgcctaccgcagctcctcagccaaccgcctcttccgcgtcatccgtagagagcacggagaccccctcatcgaggagctcaatcccggcgacgccttggagcctgagggccggggcacagggggtgtggtgaccgacttcgacggagacgggatgctggacctcatcttgtcccatggagagtccatggctcagccgctgtccgtcttccggggcaatcagggcttcaacaacaactggctgcgagtggtgccacgcacccggtttggggcctttgccaggggagctaaggtcgtgctctacaccaagaagagtggggcccacctgaggatcatcgacgggggctcaggctacctgtgtgagatggagcccgtggcacactttggcctggggaaggatgaagccagcagtgtggaggtgacgtggccagatggcaagatggtgagccggaacgtggccagcggggagatgaactcagtgctggagatcctctacccccgggatgaggacacacttcaggacccagccccactggagtgtggccaaggattctcccagcaggaaaatggccattgcatggacaccaatgaatgcatccagttcccattcgtgtgccctcgagacaagcccgtatgtgtcaacacctatggaagctacaggtgccggaccaacaagaagtgcagtcggggctacgagcccaacgaggatggcacagcctgcgtggggactctcggccagtcaccgggcccccgccccaccacccccaccgctgctgctgccactgccgctgctgctgccgctgctggagctgccactgctgcaccggtcctcgtagatggagatctcaatctggggtcggtggttaaggagagctgcgagcccagctgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - bone morphogenetic protein 5 - transmembrane protein 143 - tryptophanyl-tRNA synthetase - plexin domain containing 2 |