Cart 17 Product Products 2 668,65 € (empty)
-
-
-
-
-
-
1 x HEYL-hairy...121,50 € -
1 x ABHD2-abhy...121,50 € -
-
-
-
1 x HSP27...259,07 € -
1 x AMPKα2...259,07 € -
-
-
-
-
No products
To be determined Shipping
2 668,65 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 668,65 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 668,65 €
Data sheet of GPR177-G protein-coupled receptor 177 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR177-G protein-coupled receptor 177 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007211 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR177 |
| Origin species: | Human |
| Product name: | GPR177-G protein-coupled receptor 177 Gene |
| Size: | 2ug |
| Accessions: | BC007211 |
| Gene id: | 79971 |
| Gene description: | G protein-coupled receptor 177 |
| Synonyms: | integral membrane protein GPR177; GPR177; C1orf139; EVI; MRP; mig-14; protein wntless homolog; G protein-coupled receptor 177; protein evenness interrupted homolog; wntless Wnt ligand secretion mediator |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagatgagtccttggttccaattcatgctgtttatcctgcagctggacattgccttcaagctaaacaaccaaatcagagaaaatgcagaagtctccatggacgtttccctggcttaccgtgatgacgcatttgctgagtggactgaaatggcccatgaaagagtaccacggaaactcaaatgcaccttcacatctcccaagactccagagcatgagggccgttactatgaatgtgatgtccttcctttcatggaaattgggtctgtggcccataagttttaccttttaaacatccggctgcctgtgaatgagaagaagaaaatcaatgtgggaattggggagataaaggatatccggttggtggggatccaccaaaatggaggcttcaccaaggtgtggtttgccatgaagaccttccttacgcccagcatcttcatcattatggtgtggtattggaggaggatcaccatgatgtcccgacccccagtgcttctggaaaaagtcatctttgcccttgggatttccatgacctttatcaatatcccagtggaatggttttccatcgggtttgactggacctggatgctgctgtttggtgacatccgacagggcatcttctatgcgatgcttctgtccttctggatcatcttctgtggcgagcacatgatggatcagcacgagcggaaccacatcgcagggtattggaagcaagtcggacccattgccgttggctccttctgcctcttcatatttgacatgtgtgagagaggggtacaactcacgaatcccttctacagtatctggactacagacattggaacagagctggccatggccttcatcatcgtggctggaatctgcctctgcctctacttcctgtttctatgcttcatggtatttcaggtgtttcggaacatcagtgggaagcagtccagcctgccagctatgagcaaagtccggcggctacactatgaggggctaatttttaggttcaagttcctcatgcttatcaccttggcctgcgctgccatgactgtcatcttcttcatcgttagtcaggtaacggaaggccattggaaatggggcggcgtcacagtccaagtgaacagtgcctttttcacaggcatctatgggatgtggaatctgtatgtctttgctctgatgttcttgtatgcaccatcccataaaaactatggagaagaccagtccaatggcgatctgggtgtccatagtggggaagaactccagctcaccaccactatcacccatgtggacggacccactgagatctacaagttgacccgcaaggaggcccaggagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin specific peptidase 25 - tripartite motif-containing 55 - tripartite motif-containing 38 - tripartite motif-containing 15 |