Cart 11 Product Products 1 437,18 € (empty)
-
-
1 x C6orf168-c...121,50 € -
1 x FAM122C-fa...113,40 € -
1 x MR1-major...121,50 € -
-
1 x FLJ34048-h...113,40 € -
1 x MPHOSPH6-M...113,40 € -
1 x SYP-synapt...121,50 € -
1 x FAM151B-fa...121,50 € -
-
1 x SLC48A1-so...113,40 €
No products
To be determined Shipping
1 437,18 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 437,18 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 437,18 €
Data sheet of HYAL1-hyaluronoglucosaminidase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HYAL1-hyaluronoglucosaminidase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC035695 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HYAL1 |
| Origin species: | Human |
| Product name: | HYAL1-hyaluronoglucosaminidase 1 Gene |
| Size: | 2ug |
| Accessions: | BC035695 |
| Gene id: | 3373 |
| Gene description: | hyaluronoglucosaminidase 1 |
| Synonyms: | HYAL-1; LUCA1; MPS9; NAT6; hyaluronidase-1; luCa-1; lung carcinoma protein 1; plasma hyaluronidase; tumor suppressor LUCA-1; hyaluronoglucosaminidase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagcccacctgcttcccatctgcgccctcttcctgaccttactcgatatggcccaaggctttaggggccccttgctacccaaccggcccttcaccaccgtctggaatgcaaacacccagtggtgcctggagaggcacggtgtggacgtggatgtcagtgtcttcgatgtggtagccaacccagggcagaccttccgcggccctgacatgacaattttctatagctcccagctgggcacctacccctactacacgcccactggggagcctgtgtttggtggtctgccccagaatgccagcctgattgcccacctggcccgcacattccaggacatcctggctgccatacctgctcctgacttctcagggctggcagtcatcgactgggaggcatggcgcccacgctgggccttcaactgggacaccaaggacatttaccggcagcgctcacgggcactggtacaggcacagcaccctgattggccagctcctcaggtggaggcagtagcccaggaccagttccagggagctgcacgggcctggatggcaggcaccctccagctggggcgggcactgcgtcctcgcggcctctggggcttctatggcttccctgactgctacaactatgactttctaagccccaactacaccggccagtgcccatcaggcatccgtgcccaaaatgaccagctagggtggctgtggggccagagccgtgccctctatcccagcatctacatgcccgcagtgctggagggcacagggaagtcacagatgtatgtgcaacaccgtgtggccgaggcattccgtgtggctgtggctgctggtgaccccaatctgccggtgctgccctatgtccagatcttctatgacacgacaaaccactttctgcccctggatgagctggagcacagcctgggggagagtgcggcccagggggcagctggagtggtgctctgggtgagctgggaaaatacaagaaccaaggaatcatgtcaggccatcaaggagtatatggacactacactggggcccttcatcctgaacgtgaccagtggggcccttctctgcagtcaagccctgtgctccggccatggccgctgtgtccgccgcaccagccaccccaaagccctcctcctccttaaccctgccagtttctccatccagctcacgcctggtggtgggcccctgagcctgcggggtgccctctcacttgaagatcaggcacagatggctgtggagttcaaatgtcgatgctaccctggctggcaggcaccgtggtgtgagcggaagagcatgtggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - serine/threonine kinase 40 - proline-rich coiled-coil 1 - serine/threonine kinase 38 - clusterin-like 1 (retinal) |