Cart 2 Product Products 234,90 € (empty)
-
1 x USH1G-Ushe...121,50 € -
1 x H3F3A-H3...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
View larger 
ALS2CR12-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 Gene
PTXBC031603
New product
Data sheet of ALS2CR12-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ALS2CR12-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031603 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ALS2CR12 |
| Origin species: | Human |
| Product name: | ALS2CR12-amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 Gene |
| Size: | 2ug |
| Accessions: | BC031603 |
| Gene id: | 130540 |
| Gene description: | amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12 |
| Synonyms: | amyotrophic lateral sclerosis 2 chromosomal region candidate gene 12 protein; amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12; amyotrophic lateral sclerosis 2 chromosome region candidate 12 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtaccccaaccctctcatctactgcacctgctgggacccctggaacttgggaccacggaagctaatcaagacccctcaactaccacgcaagaactccacagggagttccaagctaactcctcttctaccagctccaaaaaatcacaattacctccaaccaacaaaacctgttgtttccccaaaaatgaaaatccattcagcaaggcaagaagagactaataaatcattttatgaagtgatcaacgtgtcacctggctatcaacttgttcggaatcgggaacagatttctgtcaccttaggggatgagatgtttgataggaaaaagcggtgggaatcggagatcccggacaaaggcagattttccaggaccaacatcatttctgacctagaagagcaaatctcagagctgacagcaataattgaacaaatgaacagagaccaccagtctgcccagaaattgctctccagtgaaatggatctccgctgtgctgagatgaaacagaactttgaaaacaagaacagggagctcaaagaggcccatgaagcagaactcagtgagttggagaacaactacaaagcagccttgaaggcagagaagttggctgcccaagagaagctagaggagatgggaaaagaatacaagtatttgaagaatatgtttcgtacgtatcaggacagtatttatgatgaaatggaagagaagtggtcaaaacagaaggcgaaatggaagaaggatgagaagttcgagcgagaaaatatcctgctacagcaaaaaaaaaagatgaccaaaaaattcgaaatggagtcaggagaagaagataagaaaataaatgaatcctgcagtgctgtctttgagaacttcattcaagagaaggaggagctcttgaaacaacatcaaagtgacaccttgcaattagaagagctgagaaaaaccaaagaggtcatgcaggaagaattgcatgcacaagcccttatcctagagtcactgaacacaaacctctactatacccagttggaactccagaaagagaaagctatagtgggaaatctggagaaaatgcttcaaaccaagtttgctgaaactgaagaaaagtataagcacaccatacagatcctgacggaagagaacattcatctgaagcaaaagataatttctaagaatgaagaaatttgtgaaggatgttctgggagattggcctctattactgtttctaaggatgattctgacactgtgcaagatggtagcaagaaaggacaagaatcataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dopachrome tautomerase (dopachrome delta-isomerase, tyrosine-related protein 2) - solute carrier family 2 (facilitated glucose/fructose transporter), member 5 - amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11 - SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1 |