Cart 3 Product Products 754,40 € (empty)
-
1 x LOC404266-...113,40 € -
1 x FBXL14-F-b...121,50 € -
No products
To be determined Shipping
754,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 754,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 754,40 €
View larger 
Data sheet of IKZF5-IKAROS family zinc finger 5 (Pegasus) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IKZF5-IKAROS family zinc finger 5 (Pegasus) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022564 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IKZF5 |
| Origin species: | Human |
| Product name: | IKZF5-IKAROS family zinc finger 5 (Pegasus) Gene |
| Size: | 2ug |
| Accessions: | BC022564 |
| Gene id: | 64376 |
| Gene description: | IKAROS family zinc finger 5 (Pegasus) |
| Synonyms: | PEGASUS; ZNFN1A5; zinc finger protein Pegasus; zinc finger protein, subfamily 1A, 5 (Pegasus); zinc finger transcription factor Pegasus; IKAROS family zinc finger 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggtgaaaaaaaaccagagcctttggacttcgtgaaagattttcaggaatacctgactcagcagacccatcacgtgaacatgatttctggatcagttagtggggacaaagaagcagaggctcttcagggagctggaacagatggtgatcaaaatggacttgatcacccatctgttgaagtttccttggatgaaaactcaggaatgttagtagacgggtttgaaaggacctttgatgggaagcttaagtgtcggtactgcaactatgccagcaaaggaacagcccggcttattgaacacatcagaatccacacaggtgaaaaacctcatcgatgtcatctttgtccatttgcatctgcttatgagcgtcatctggaagcccatatgcgttctcatactggagaaaaaccatacaaatgtgaattatgttccttccgctgcagtgatcgaagtaacttgtcccatcatcgaaggcgcaagcataaaatggtaccaattaaaggtactaggtcttccttaagcagcaagaaaatgtggggggttttacagaagaaaacaagcaatctgggctatagcagaagagcactaatcaacttaagtccaccttccgtggtggttcagaaaccagactaccttaacgattttacccacgaaatcccaaatatccagactgactcctatgaaagtatggcaaaaaccacaccaactggtggccttccaagggacccccaagaactcatggttgataaccctttgaatcagctctcgactctagcagggcagttgtccagtctgccacccgaaaaccaaaaccctgcatcacctgatgtagttccctgccctgatgaaaagcctttcatgattcagcagccctctacccaagcagtagtttctgccgtatcagcaagtattcctcagagctcctctcccacaagcccagaacctcggccatcccatagtcaaaggaactatagtccagtggcaggtccaagcagtgagccaagtgcccacacgagcactcccagcataggaaacagccagccaagcaccccagccccagccctgccggtccaggaccctcagcttctgcaccactgccagcactgtgatatgtactttgcagacaacatcctttacactattcatatgggatgtcatgggtatgaaaatccttttcagtgtaatatatgtggatgcaaatgtaaaaacaagtatgattttgcctgtcattttgcaagagggcacataaccaacattgattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 35, member A5 - solute carrier family 35, member A5 - NOL1/NOP2/Sun domain family, member 5 - NOL1/NOP2/Sun domain family, member 6 |