Cart 1 Product Products 112,04 € (empty)
No products
To be determined Shipping
112,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 112,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 112,04 €
Data sheet of MGC24975-hypothetical protein MGC24975 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MGC24975-hypothetical protein MGC24975 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC023278 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MGC24975 |
| Origin species: | Human |
| Product name: | MGC24975-hypothetical protein MGC24975 Gene |
| Size: | 2ug |
| Accessions: | BC023278 |
| Gene id: | 163154 |
| Gene description: | hypothetical protein MGC24975 |
| Synonyms: | proline-rich protein 22; proline rich 22 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagccccaaagacaagctctgtgtcatccatcacccagccagggccccaaagcaatatctatgtcgtcccccaaaggggccccccaatggcaaggttcttgtggcatctcccaaacaggcccccaggcttgggctgggcccctcaggcagcagctgctctcagggcacccgcctgccgcccacaggtttccagatggccccatgcgggtgcttcttcgacccccgcatctatcggatcgagtggaccacccccgacctgggccagtcagccctgtataagctggcagcaagcagcggggggccagcgggggtcccctccgccccaggcagctacctcctggagcctcagccctacctcaaggccccggggctgcctccatacccccactaccagcaggcacccggggggccccagtttctcttgccctacttcccgcctgagggccccgggccagaggctctgggttttgtgggggacgcagggcccgccgccttcgtggagctgcccctaccgcccctagaggaaggcccggccccgctgccacccccaccccccaaggagaacaagccgccccctgtactcatcacgctgcctgcagagcccacactgcccccagacgcctacagccacctccagggtcacctcggccacttccctgggcccgaacccctggccttccccgtcaaggagctgcagggcagtggggcccgacctggggtgcccctgtacccaccgggcctcagcgagctcaaggtggccgaggtcaaggagggggccctgctgggagcaggcaaggccaaggcccccaagacggccagagctttggcactgcctgacaaggttctgctggaggacgccatgaagctcttcgactgcctgccaggcgcctctgagcctgagggtaccctgtgcgaggtccctgggccggccctgcctgacagcagtggtgggaactcagccgatgacatccgctcgctgtgcctgcccgaggagctgctgtcctttgactacagcgtgcctgagatcctggacaccgtgtccaacgttgactacttcttcaacttcaaggcgctcgacgaggagcagccgccccacccggggccccctgccaccaacaccccggcccccattctgtctggcaagagaaaggcctcgacggccaagaagggaaagccgggaaggaaggccaggcagccggcaggcccagccagcgccactcccccggggcccagggaggacctgggagccaccccgcattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - EF-hand domain family, member A1 - EF-hand domain family, member A1 - cerebral cavernous malformation 2 - hypothetical protein FLJ10404 |