Cart 12 Product Products 1 704,08 € (empty)
-
-
1 x MGC9913-hy...113,40 € -
1 x DDOST-doli...121,50 € -
1 x GPR82-G...121,50 € -
1 x LOC440905-...113,40 € -
1 x MGC16075-h...113,40 € -
1 x FGFBP1-fib...113,40 € -
1 x CREB3L2-cA...113,40 € -
1 x SNAPC5-sma...113,40 € -
1 x CERK-ceram...113,40 € -
1 x VPS24-vacu...113,40 € -
1 x DMC1-DMC1...121,50 €
No products
To be determined Shipping
1 704,08 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 704,08 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 704,08 €
View larger 
SUV39H1-suppressor of variegation 3-9 homolog 1 (Drosophila) Gene
PTXBC006238
New product
Data sheet of SUV39H1-suppressor of variegation 3-9 homolog 1 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SUV39H1-suppressor of variegation 3-9 homolog 1 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006238 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUV39H1 |
| Origin species: | Human |
| Product name: | SUV39H1-suppressor of variegation 3-9 homolog 1 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC006238 |
| Gene id: | 6839 |
| Gene description: | suppressor of variegation 3-9 homolog 1 (Drosophila) |
| Synonyms: | histone-lysine N-methyltransferase SUV39H1; H3-K9-HMTase 1; KMT1A; MG44; SUV39H; Su(var)3-9 homolog 1; histone H3-K9 methyltransferase 1; histone-lysine N-methyltransferase, H3 lysine-9 specific 1; lysine N-methyltransferase 1A; position-effect variegation 3-9 homolog; suppressor of variegation 3-9 homolog 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggaaaatttaaaaggctgcagcgtgtgttgcaagtcttcttggaatcagctgcaggacctgtgccgcctggccaagctctcctgccctgccctcggtatctctaagaggaacctctatgactttgaagtcgagtacctgtgcgattacaagaagatccgcgaacaggaatattacctggtgaaatggcgtggatatccagactcagagagcacctgggagccacggcagaatctcaagtgtgtgcgtatcctcaagcagttccacaaggacttagaaagggagctgctccggcggcaccaccggtcaaagaccccccggcacctggacccaagcttggccaactacctggtgcagaaggccaagcagaggcgggcgctccgtcgctgggagcaggagctcaatgccaagcgcagccatctgggacgcatcactgtagagaatgaggtggacctggacggccctccgcgggccttcgtgtacatcaatgagtaccgtgttggtgagggcatcaccctcaaccaggtggctgtgggctgcgagtgccaggactgtctgtgggcacccactggaggctgctgcccgggggcgtcactgcacaagtttgcctacaatgaccagggccaggtgcggcttcgagccgggctgcccatctacgagtgcaactcccgctgccgctgcggctatgactgcccaaatcgtgtggtacagaagggtatccgatatgacctctgcatcttccgcacggatgatgggcgtggctggggcgtccgcaccctggagaagattcgcaagaacagcttcgtcatggagtacgtgggagagatcattacctcagaggaggcagagcggcggggccagatctacgaccgtcagggcgccacctacctctttgacctggactacgtggaggacgtgtacaccgtggatgccgcctactatggcaacatctcccactttgtcaaccacagttgtgaccccaacctgcaggtgtacaacgtcttcatagacaaccttgacgagcggctgccccgcatcgctttctttgccacaagaaccatccgggcaggcgaggagctcacctttgattacaacatgcaagtggaccccgtggacatggagagcacccgcatggactccaactttggcctggctgggctccctggctcccctaagaagcgggtccgtattgaatgcaagtgtgggactgagtcctgccgcaaatacctcttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - fucosyltransferase 11 (alpha (1,3) fucosyltransferase) - cytochrome P450, family 3, subfamily A, polypeptide 5 - cytochrome P450, family 2, subfamily S, polypeptide 1 - cytochrome P450, family 4, subfamily X, polypeptide 1 |