Cart 32 Product Products 4 702,12 € (empty)
-
1 x VN1R2-vome...121,50 € -
1 x Lecithin-C...744,00 € -
1 x C5orf32-ch...113,40 € -
1 x UCKL1-urid...121,50 € -
1 x FBXW12-F-b...121,50 € -
1 x ATPIF1-ATP...113,40 € -
1 x FDFT1-farn...121,50 € -
1 x PRRC1-prol...121,50 € -
1 x EXTL2-exos...121,50 € -
1 x AHNAK2-AHN...121,50 € -
1 x FLJ25328-h...113,40 € -
1 x ENTPD8-ect...121,50 € -
1 x SGTB-small...121,50 € -
1 x ADORA3-ade...121,50 € -
-
1 x FSD1L-fibr...121,50 € -
1 x NCAPD3-non...121,50 € -
1 x RRAGC-Ras-...121,50 € -
1 x C1orf91-ch...113,40 € -
1 x DMRTC1-DMR...113,40 € -
1 x C16orf5-ch...113,40 € -
1 x RDBP-RD...121,50 € -
1 x RBM34-RNA...121,50 € -
1 x Phospho-Ne...259,07 € -
1 x SYT11-syna...121,50 € -
1 x U2AF2-U2...121,50 € -
1 x RP11-265F1...121,50 € -
1 x MAGE-A5...259,07 € -
1 x C11orf49-c...121,50 € -
1 x SNX5-sorti...113,40 € -
1 x NUP62CL-nu...113,40 € -
1 x C17orf97-c...121,50 €
No products
To be determined Shipping
4 702,12 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 32 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 702,12 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 702,12 €
Data sheet of GPR182-G protein-coupled receptor 182 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR182-G protein-coupled receptor 182 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034761 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR182 |
| Origin species: | Human |
| Product name: | GPR182-G protein-coupled receptor 182 Gene |
| Size: | 2ug |
| Accessions: | BC034761 |
| Gene id: | 11318 |
| Gene description: | G protein-coupled receptor 182 |
| Synonyms: | 7TMR; ADMR; AM-R; AMR; G10D; gamrh; hrhAMR; G-protein coupled receptor 182; adrenomedullin receptor; G protein-coupled receptor 182 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcagtgaaacccagctgggggcctggcccctcggagggggtcaccgcagtgcctaccagtgaccttggagagatccacaactggaccgagctgcttgacctcttcaaccacactttgtctgagtgccacgtggagctcagccagagcaccaagcgcgtggtcctctttgccctctacctggccatgtttgtggttgggctggtggagaacctcctggtgatatgcgtcaactggcgcggctcaggccgggcagggctgatgaacctctacatcctcaacatggccatcgcggacctgggcattgtcctgtctctgcccgtgtggatgctggaggtcacgctggactacacctggctctggggcagcttctcctgccgcttcactcactacttctactttgtcaacatgtatagcagcatcttcttcctggtgtgcctcagtgtcgaccgctatgtcaccctcaccagcgcctccccctcctggcagcgttaccagcaccgagtgcggcgggccatgtgtgcaggcatctgggtcctctcggccatcatcccgctgcctgaggtggtccacatccagctggtggagggccctgagcccatgtgcctcttcatggcaccttttgaaacgtacagcacctgggccctggcggtggccctgtccaccaccatcctgggcttcctgctgcccttccctctcatcacagtcttcaatgtgctgacagcctgccggctgcggcagccaggacaacccaagagccggcgccactgcctgctgctgtgcgcctacgtggccgtctttgtcatgtgctggctgccctatcatgtgaccctgctgctgctcacactgcatgggacccacatctccctccactgccacctggtccacctgctctacttcttctatgatgtcattgactgcttctccatgctgcactgtgtcatcaaccccatcctttacaactttctcagcccacacttccggggccggctcctgaatgctgtagtccattaccttcctaaggaccagaccaaggcgggcacatgcgcctcctcttcctcctgttccacccagcattccatcatcatcaccaagggtgatagccagcctgctgcagcagccccccaccctgagccaagcctgagctttcaggcacaccatttgcttccaaatacttcccccatctctcccactcagcctcttacacccagctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - round spermatid basic protein 1 - carboxypeptidase A2 (pancreatic) - carboxypeptidase A1 (pancreatic) - GDP-mannose pyrophosphorylase A |