Cart 1 Product Products 113,40 € (empty)
-
1 x PYCR1-pyrr...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene
PTXBC016481
New product
Data sheet of ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016481 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ASAH1 |
| Origin species: | Human |
| Product name: | ASAH1-N-acylsphingosine amidohydrolase (acid ceramidase) 1 Gene |
| Size: | 2ug |
| Accessions: | BC016481 |
| Gene id: | 427 |
| Gene description: | N-acylsphingosine amidohydrolase (acid ceramidase) 1 |
| Synonyms: | ACDase; ASAH; PHP; PHP32; SMAPME; acid ceramidase; N-acylsphingosine amidohydrolase (acid ceramidase) 1; acid CDase; acylsphingosine deacylase; N-acylsphingosine amidohydrolase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccgggccggagttgcgtcgccttagtcctcctggctgccgccgtcagctgtgccgtcgcgcagcacgcgccgccgtggacagaggactgcagaaaatcaacctatcctccttcaggaccaacgtacagaggtgcagttccatggtacaccataaatcttgacttaccaccctacaaaagatggcatgaattgatgcttgacaaggcaccaatgctaaaggttatagtgaattctctgaagaatatgataaatacattcgtgccaagtggaaaagttatgcaggtggtggatgaaaaattgcctggcctacttggcaactttcctggcccttttgaagaggaaatgaagggtattgccgctgttactgatatacctttaggagagattatttcattcaatattttttatgaattatttaccatttgtacttcaatagtagcagaagacaaaaaaggtcatctaatacatgggagaaacatggattttggagtatttcttgggtggaacataaataatgatacctgggtcataactgagcaactaaaacctttaacagtgaatttggatttccaaagaaacaacaaaactgtcttcaaggcttcaagctttgctggctatgtgggcatgttaacaggattcaaaccaggactgttcagtcttacactgaatgaacgtttcagtataaatggtggttatctgggtattctagaatggattctgggaaagaaagatgccatgtggatagggttcctcactagaacagttctggaaaatagcacaagttatgaagaagccaagaatttattgaccaagaccaagatattggccccagcctactttatcctgggaggcaaccagtctggggaaggttgtgtgattacacgagacagaaaggaatcattggatgtatatgaactcgatgctaagcagggtagatggtatgtggtacaaacaaattatgaccgttggaaacatcccttcttccttgatgatcgcagaacgcctgcaaagatgtgtctgaaccgcaccagccaagagaatatctcatttgaaaccatgtatgatgtcctgtcaacaaaacctgtcctcaacaagctgaccgtatacacaaccttgatagatgttaccaaaggtcaattcgaaacttacctgcgggactgccctgacccttgtataggttggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - queuine tRNA-ribosyltransferase domain containing 1 - acyl-Coenzyme A dehydrogenase, short/branched chain - golgi associated PDZ and coiled-coil motif containing - early growth response 2 (Krox-20 homolog, Drosophila) |