Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BRE-brain and reproductive organ-expressed (TNFRSF1A modulator) Gene
PTXBC001251
New product
Data sheet of BRE-brain and reproductive organ-expressed (TNFRSF1A modulator) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BRE-brain and reproductive organ-expressed (TNFRSF1A modulator) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001251 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BRE |
| Origin species: | Human |
| Product name: | BRE-brain and reproductive organ-expressed (TNFRSF1A modulator) Gene |
| Size: | 2ug |
| Accessions: | BC001251 |
| Gene id: | 9577 |
| Gene description: | brain and reproductive organ-expressed (TNFRSF1A modulator) |
| Synonyms: | BRCA1-A complex subunit BRE; BRCC4; BRCC45; BRCA1/BRCA2-containing complex subunit 45; BRCA1/BRCA2-containing complex, subunit 4; brain and reproductive organ-expressed protein; brain and reproductive organ-expressed (TNFRSF1A modulator) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccccagaagtggccttgaaccgaatatctccaatgctctcccctttcatatctagcgtggtccggaatggaaaagtgggactggatgctacaaactgtttgaggataactgacttaaaatctggctgcacatcattgactcctgggcccaactgtgaccgatttaaactgcacataccatatgctggagagacattaaagtgggatatcattttcaatgcccaatacccagaactgcctcccgattttatctttggagaagatgctgaattcctgccagacccctcagctttgcagaatcttgcctcctggaatccttcaaatcctgaatgtctcttacttgtggtgaaggaacttgtgcaacaatatcaccaattccaatgtagccgcctccgggagagctcccgcctcatgtttgaataccagacattactggaggagccacagtatggagagaacatggaaatttatgctgggaaaaaaaacaactggactggtgaattttcagctcgtttccttttgaagctgcccgtagatttcagcaatatccccacataccttctcaaggatgtaaatgaagaccctggagaagatgtggccctcctctctgttagttttgaggacactgaagccacccaggtgtaccccaagctgtacttgtcacctcgaattgagcatgcacttggaggctcctcagctcttcatatcccagcttttccaggaggaggatgtctcattgattacgttcctcaagtatgccacctgctcaccaacaaggtgcagtacgtgattcaagggtatcacaaaagaagagagtatattgctgcttttctcagtcactttggcacaggtgtcgtggaatatgatgcagaaggctttacaaaactcactctgctgctgatgtggaaagatttttgttttcttgtacacattgacctgcctctgtttttccctcgagaccagccaactctcacatttcagtccgtttatcactttaccaacagtggacagctttactcccaggcccaaaaaaattatccgtacagccccagatgggatggaaatgaaatggccaaaagagcaaaggcttatttcaaaacctttgtccctcagttccaggaggcagcatttgccaatggaaagctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (RNA) III (DNA directed) polypeptide D, 44kDa - polymerase (RNA) III (DNA directed) polypeptide C (62kD) - acyl-Coenzyme A dehydrogenase, C-4 to C-12 straight chain - solute carrier family 39 (zinc transporter), member 14 |