Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL13RA2-interleukin 13 receptor, alpha 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL13RA2-interleukin 13 receptor, alpha 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020739 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL13RA2 |
| Origin species: | Human |
| Product name: | IL13RA2-interleukin 13 receptor, alpha 2 Gene |
| Size: | 2ug |
| Accessions: | BC020739 |
| Gene id: | 3598 |
| Gene description: | interleukin 13 receptor, alpha 2 |
| Synonyms: | CD213A2; CT19; IL-13R; IL13BP; interleukin-13 receptor subunit alpha-2; IL-13 receptor subunit alpha-2; IL-13R subunit alpha-2; IL-13R-alpha-2; IL-13RA2; cancer/testis antigen 19; interleukin 13 binding protein; interleukin 13 receptor alpha 2 chain; interleukin 13 receptor, alpha 2; interleukin 13 receptor subunit alpha 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctttcgtttgcttggctatcggatgcttatatacctttctgataagcacaacatttggctgtacttcatcttcagacaccgagataaaagttaaccctcctcaggattttgagatagtggatcccggatacttaggttatctctatttgcaatggcaacccccactgtctctggatcattttaaggaatgcacagtggaatatgaactaaaataccgaaacattggtagtgaaacatggaagaccatcattactaagaatctacattacaaagatgggtttgatcttaacaagggcattgaagcgaagatacacacgcttttaccatggcaatgcacaaatggatcagaagttcaaagttcctgggcagaaactacttattggatatcaccacaaggaattccagaaactaaagttcaggatatggattgcgtatattacaattggcaatatttactctgttcttggaaacctggcataggtgtacttcttgataccaattacaacttgttttactggtatgagggcttggatcatgcattacagtgtgttgattacatcaaggctgatggacaaaatataggatgcagatttccctatttggaggcatcagactataaagatttctatatttgtgttaatggatcatcagagaacaagcctatcagatccagttatttcacttttcagcttcaaaatatagttaaacctttgccgccagtctatcttacttttactcgggagagttcatgtgaaattaagctgaaatggagcatacctttgggacctattccagcaaggtgttttgattatgaaattgagatcagagaagatgatactaccttggtgactgctacagttgaaaatgaaacatacaccttgaaaacaacaaatgaaacccgacaattatgctttgtagtaagaagcaaagtgaatatttattgctcagatgacggaatttggagtgagtggagtgataaacaatgctgggaaggtgaagacctatcgaagaaaactttgctacgtttctggctaccatttggtttcatcttaatattagttatatttgtaaccggtctgcttttgcgtaagccaaacacctacccaaaaatgattccagaatttttctgtgatacatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transforming growth factor, beta 1 - RNA binding motif protein, X-linked - Smad nuclear interacting protein 1 - sphingosine-1-phosphate receptor 5 |