Cart 3 Product Products 342,04 € (empty)
-
-
1 x IGF2-insul...113,40 € -
1 x HDGFRP3-he...113,40 €
No products
To be determined Shipping
342,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 342,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 342,04 €
View larger 
GPD2-glycerol-3-phosphate dehydrogenase 2 (mitochondrial) Gene
PTXBC019874
New product
Data sheet of GPD2-glycerol-3-phosphate dehydrogenase 2 (mitochondrial) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPD2-glycerol-3-phosphate dehydrogenase 2 (mitochondrial) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019874 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPD2 |
| Origin species: | Human |
| Product name: | GPD2-glycerol-3-phosphate dehydrogenase 2 (mitochondrial) Gene |
| Size: | 2ug |
| Accessions: | BC019874 |
| Gene id: | 2820 |
| Gene description: | glycerol-3-phosphate dehydrogenase 2 (mitochondrial) |
| Synonyms: | GDH2; GPDM; mGPDH; glycerol-3-phosphate dehydrogenase, mitochondrial; GPD-M; GPDH-M; glycerol-3-phosphate dehydrogenase 2 (mitochondrial); mitochondrial glycerophosphate dehydrogenase; mtGPD; testicular tissue protein Li 76; glycerol-3-phosphate dehydrogenase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcatttcaaaaggcagtgaaagggactcttgttggaggaggtgctcttgcaactgttttaggactttctcagtttgctcattacagaaggaaacaaatgaacctggcctatgttaaagcagcagactgcatttcagaaccagttaacagggagcctccttccagagaagctcagctactgactttgcaaaacacatctgaatttgatatccttgttattggaggaggagcaacaggaagtggctgtgcgctagatgctgtcaccagaggactaaaaacagcccttgtagaaagagatgatttctcatcagggaccagcagcagaagcactaaattgatccatggtggtgtgagatatctgcagaaggccatcatgaagttggatattgagcagtataggatggtaaaagaagcccttcatgagcgtgccaacctgctagaaattgctccccatttatcagctccattgcctataatgcttccagtttacaagtggtggcagttaccttactactgggtaggaatcaagctgtatgatttggttgcaggaagcaattgcctaaaaagcagttatgtcctcagcaaatcaagagcccttgaacatttcccaatgctccagaaggacaaactggtaggagcaattgtctactatgacggacaacataacgatgcacggatgaaccttgccattgctctgactgctgccaggtatggggctgccacagccaattacatggaggtagtgagcttgctcaagaagacagacccccagacagggaaagtgcatgtgagcggcgcacggtgcaaggatgtcctcacagggcaggaatttgacgtgagagccaaatgtgttatcaatgccacgggacctttcacggactctgtgcgcaaaatggatgataaagacgcagcagctatctgccagccaagtgctggtgtccatattgtgatgcctggttattacagcccagagagcatgggacttcttgacccagcgaccagtgatgggcgagttattttcttcttaccctggcaaaagatgacgatcgctggcactactgatactccaactgatgttacacaccatccaattccttcagaagaagatatcaacttcattttgaatgaagtataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - intraflagellar transport 81 homolog (Chlamydomonas) - major facilitator superfamily domain containing 11 - bactericidal/permeability-increasing protein-like 1 - protein tyrosine phosphatase, non-receptor type 11 |