Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HLA-C-major histocompatibility complex, class I, C Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HLA-C-major histocompatibility complex, class I, C Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002463 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HLA-C |
| Origin species: | Human |
| Product name: | HLA-C-major histocompatibility complex, class I, C Gene |
| Size: | 2ug |
| Accessions: | BC002463 |
| Gene id: | 3107 |
| Gene description: | major histocompatibility complex, class I, C |
| Synonyms: | major histocompatibility antigen HLA-C; MHC class I antigen heavy chain HLA-C; HLA-C antigen; HLA-C alpha chain; D6S204; HLA-JY3; HLAC; HLC-C; MHC; PSORS1; HLA class I histocompatibility antigen, Cw-1 alpha chain; HLA class I histocompatibility antigen, C alpha chain; human leukocyte antigen-C alpha chain; major histocompatibility complex, class I, C |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgggtcatggcgccccgaaccctcatcctgctgctctcgggagccctggccctgaccgagacctgggcctgctcccactccatgaggtatttctacaccgccgtgtcccggcccggccgcggagagccccgcttcatcgcagtgggctacgtggacgacacgcagttcgtgcggttcgacagcgacgccgcgagtccaagaggggagccgcgggcgccgtgggtggagcaggaggggccggagtattgggaccgggagacacagaagtacaagcgccaggcacagactgaccgagtgagcctgcggaacctgcgcggctactacaaccagagcgaggccgggtctcacaccctccagtggatgtatggctgcgacctggggcccgacgggcgcctcctccgcgggtatgaccagtccgcctacgacggcaaggattacatcgccctgaacgaggacctgcgctcctggaccgccgcggacacggcggctcagatcacccagcgcaagtgggaggcggcccgtgcggcggagcagcagagagcctacctggagggcacgtgcgtggagtggctccgcagatacctggagaacgggaaggagacgctgcagcgcgcggaacacccaaagacacacgtgacccaccatctcgtctctgaccatgaggccaccctgaggtgctgggccctgggcttctaccctgcggagatcacactgacctggcagcgggatggcgaggaccaaactcaggacaccgagcttgtggagaccaggccagcaggagatggaaccttccagaagtgggcagctgtggtggtgccttctggagaagagcagagatacacgtgccatgtgcagcacgaggggctgccggagcccctcaccctgagatgggagccatcttcccagcccaccatccccatcgtgggcatcgttgctggcctggctgtcctggctgtcctagctgtcctaggagctgtggtggctgttgttatgtgtaggaggaagagctcaggtggaaaaggagggagctgctctcaggctgcgtccagcaacagtgcccagggctctgatgagtctctcatcgcttgtaaagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phosphatase and tensin homolog pseudogene 1 - aldehyde dehydrogenase 3 family, member B2 - alkB, alkylation repair homolog 1 (E. coli) - ARP6 actin-related protein 6 homolog (yeast) |