Cart 4 Product Products 1 235,75 € (empty)
-
-
1 x ANKHD1-ank...121,50 € -
1 x ABI2-abl...121,50 € -
No products
To be determined Shipping
1 235,75 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 4 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 235,75 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 235,75 €
View larger 
VPS72-vacuolar protein sorting 72 homolog (S. cerevisiae) Gene
PTXBC003151
New product
Data sheet of VPS72-vacuolar protein sorting 72 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VPS72-vacuolar protein sorting 72 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003151 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS72 |
| Origin species: | Human |
| Product name: | VPS72-vacuolar protein sorting 72 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC003151 |
| Gene id: | 6944 |
| Gene description: | vacuolar protein sorting 72 homolog (S. cerevisiae) |
| Synonyms: | CFL1; Swc2; TCFL1; YL-1; vacuolar protein sorting-associated protein 72 homolog; transcription factor-like 1; transformation suppressor gene YL-1; vacuolar protein sorting 72 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtttggctgggggccgggcaccccggaagaccgctgggaaccggctttctgggcttttggaggcagaggaggaagatgagttctaccagacgacttatgggggtttcacagaggaatccggagatgatgagtatcaaggggaccagtcagacacagaggacgaagtggactctgactttgacattgatgaaggggatgaaccatccagtgatggagaagcagaagagccaagaaggaagcgccgagtagtcaccaaggcctataaggaacctctcaagagcttaaggcctcgaaaggtcaacaccccggctggtagctctcagaaggcgcgagaagagaaggcactactgccattagaactacaagatgacggctctgacagtcggaagtctatgcgtcagtctacagctgagcatacacgacaaacgttccttcgggtacaggagaggcagggccagtcaagacggcgaaaggggccccactgtgagcggccactaacccaggaggaactgctccgggaggccaagatcacagaagagcttaatttacggtcactggagacatatgagcggctcgaggctgataaaaagaagcaggttcataagaagcggaagtgccccgggcccataatcacctatcattcagtgacagtgccacttgttggggagccaggccccaaggaagagaacgttgacatagaaggacttgatcctgctccctcggtgtctgcattgactcctcatgctgggactggacccgtcaacccccctgctcgctgctcacgtaccttcatcacttttagtgatgatgcaactttcgaggaatggttcccccaagggcggcccccaaaagtccctgttcgtgaggtctgtccagtgacccatcgtccagccctataccgggaccctgttacagacataccctatgccactgctcgagccttcaagatcattcgtgaggcttacaagaagtacattactgcccatggactgccgcccactgcctcagccctgggccccggcccgccacctcctgagcccctccctggctctgggccccgagccttgcgccagaaaattgtcattaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycerol-3-phosphate dehydrogenase 2 (mitochondrial) - intraflagellar transport 81 homolog (Chlamydomonas) - major facilitator superfamily domain containing 11 - bactericidal/permeability-increasing protein-like 1 |