Cart 5 Product Products 575,10 € (empty)
-
1 x TCEAL4-tra...113,40 € -
1 x SNAPC3-sma...113,40 € -
1 x C6orf141-c...113,40 € -
1 x FLJ36144-h...121,50 € -
1 x RHOC-ras...113,40 €
No products
To be determined Shipping
575,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 575,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 575,10 €
Data sheet of CHST10-carbohydrate sulfotransferase 10 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CHST10-carbohydrate sulfotransferase 10 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010441 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CHST10 |
| Origin species: | Human |
| Product name: | CHST10-carbohydrate sulfotransferase 10 Gene |
| Size: | 2ug |
| Accessions: | BC010441 |
| Gene id: | 9486 |
| Gene description: | carbohydrate sulfotransferase 10 |
| Synonyms: | HNK-1ST; HNK1ST; carbohydrate sulfotransferase 10; HNK-1 sulfotransferase; huHNK-1ST |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcaccaccagtggcttctgctggccgcatgcttttgggtgattttcatgttcatggtggctagcaagttcatcacgttgacctttaaagacccagatgtgtacagtgccaaacaggagtttctgttcctgacaaccatgccggaagtgaggaagttgccagaagagaagcacattcctgaggaactgaagccaactgggaaggagcttccagacagccagctcgttcagcccctggtctacatggagcgcctggaactcatcagaaacgtctgcagggatgatgccctgaagaatctctcgcacactcctgtctccaagtttgtcctggaccgaatatttgtctgtgacaagcacaagattcttttctgccagactcccaaagtgggcaacacccagtggaagaaagtgctgattgttctaaatggagcattttcttccattgaggagatccccgaaaacgtggtgcacgaccacgagaagaacggccttcctcggctctcttccttcagtgatgcagaaattcagaagcgattgaaaacatacttcaagttttttattgtaagagatcccttcgaaagacttatttctgcatttaaggataaatttgttcacaatccccggtttgagccttggtacaggcatgagattgctcctggcatcatcagaaaatacaggaggaaccggacagagacgcgggggatccagtttgaagatttcgtgcgctacctcggcgatccgaaccacagatggctagaccttcagtttggggaccacatcattcactgggtgacgtatgtagagctctgtgctccctgtgagataatgtacagtgtgattggacaccacgagaccctggaggacgatgccccatacatcttaaaagaggctggcattgaccacctggtgtcatacccgactatccctccgggcattaccgtgtataacagaaccaaggtggagcactatttcctgggcatcagcaaacgagacatccgacgcctgtatgcccgtttcgaaggggactttaagctctttgggtaccagaaaccagactttttgctaaactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin D-type binding-protein 1 - Cdk5 and Abl enzyme substrate 1 - LAG1 homolog, ceramide synthase 3 - LAG1 homolog, ceramide synthase 3 |