Cart 16 Product Products 3 501,34 € (empty)
-
-
-
1 x hCG_181173...113,40 € -
1 x CCNI2-cycl...121,50 € -
1 x CCDC54-coi...121,50 € -
1 x HBD-hemogl...113,40 € -
1 x MKRN3-mako...113,40 € -
-
-
1 x UGCG-UDP-g...121,50 € -
1 x GEMIN7-gem...113,40 € -
1 x TMEM53-tra...121,50 € -
1 x HAT1-histo...121,50 € -
-
-
1 x CCDC115-co...113,40 €
No products
To be determined Shipping
3 501,34 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 16 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 501,34 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 501,34 €
View larger 
Data sheet of BCAT2-branched chain aminotransferase 2, mitochondrial Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BCAT2-branched chain aminotransferase 2, mitochondrial Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004243 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BCAT2 |
| Origin species: | Human |
| Product name: | BCAT2-branched chain aminotransferase 2, mitochondrial Gene |
| Size: | 2ug |
| Accessions: | BC004243 |
| Gene id: | 587 |
| Gene description: | branched chain aminotransferase 2, mitochondrial |
| Synonyms: | BCAM; BCATM; BCT2; PP18; branched-chain-amino-acid aminotransferase, mitochondrial; branched chain amino-acid transaminase 2, mitochondrial; branched chain aminotransferase 2, mitochondrial; placental protein 18; branched chain amino acid transaminase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacacagaagcctcataagaagcctggccccggcgagcccctggtgtttgggaagacatttaccgaccacatgctgatggtggaatggaatgacaagggctggggccagccccgaatccagcccttccagaacctcacgctgcacccagcctcctccagcctccactactccctgcagctgtttgagggcatgaaggcgttcaaaggcaaagaccagcaggtgcgcctcttccgcccctggctcaacatggaccggatgctgcgctcagccatgcgcctgtgcctgccgagtttcgacaagctggagttgctggagtgcatccgccggctcatcgaagtggacaaggactgggtccccgatgccgccggcaccagcctctatgtgcggcctgtgctcattgggaacgagccctcgctgggtgtcagccagcccacgcgcgcgctcctgttcgtcattctctgcccagtgggtgcctacttccctggaggctccgtgaccccggtctccctcctggccgacccagccttcatccgggcctgggtgggcggggtcggcaactacaagttaggtgggaattatgggcccaccgtgttagtgcaacaggaggcactcaagcggggctgtgaacaggtcctctggctgtatgggcccgaccaccagctcaccgaggtgggaaccatgaacatctttgtctactggacccacgaagatggggtgctggagctggtgacgcccccgctgaatggtgttatcctgcctggagtggtcagacagagtctactggacatggctcagacctggggtgagttccgggtggtggagcgcacgatcaccatgaagcagttgctgcgggccctggaggagggccgcgtgcgggaagtctttggctcgggcaccgcttgccaggtctgcccagtgcaccgaatcctgtacaaagacaggaacctccacattcccaccatggaaaatgggcctgagctgatcctccgcttccagaaggagctgaaggagatccagtacggaatcagagcccacgagtggatgttcccggtgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - progestin and adipoQ receptor family member VIII - peroxisome proliferator-activated receptor delta - CDC42 effector protein (Rho GTPase binding) 1 - acyl-Coenzyme A dehydrogenase family, member 11 |