Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CXCR4-chemokine (C-X-C motif) receptor 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CXCR4-chemokine (C-X-C motif) receptor 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020968 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CXCR4 |
| Origin species: | Human |
| Product name: | CXCR4-chemokine (C-X-C motif) receptor 4 Gene |
| Size: | 2ug |
| Accessions: | BC020968 |
| Gene id: | 7852 |
| Gene description: | chemokine (C-X-C motif) receptor 4 |
| Synonyms: | CD184; D2S201E; FB22; HM89; HSY3RR; LAP-3; LAP3; LCR1; LESTR; NPY3R; NPYR; NPYRL; NPYY3R; WHIM; WHIMS; C-X-C chemokine receptor type 4; CD184 antigen; LPS-associated protein 3; SDF-1 receptor; chemokine (C-X-C motif) receptor 4; chemokine receptor; fusin; leukocyte-derived seven transmembrane domain receptor; lipopolysaccharide-associated protein 3; neuropeptide Y receptor Y3; neuropeptide Y3 receptor; seven transmembrane helix receptor; seven-transmembrane-segment receptor, spleen; stromal cell-derived factor 1 receptor; C-X-C motif chemokine receptor 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggggatcagtatatacacttcagataactacaccgaggaaatgggctcaggggactatgactccatgaaggaaccctgtttccgtgaagaaaatgctaatttcaataaaatcttcctgcccaccatctactccatcatcttcttaactggcattgtgggcaatggattggtcatcctggtcatgggttaccagaagaaactgagaagcatgacggacaagtacaggctgcacctgtcagtggccgacctcctctttgtcatcacgcttcccttctgggcagttgatgccgtggcaaactggtactttgggaacttcctatgcaaggcagtccatgtcatctacacagtcaacctctacagcagtgtcctcatcctggccttcatcagtctggaccgctacctggccatcgtccacgccaccaacagtcagaggccaaggaagctgttggctgaaaaggtggtctatgttggcgtctggatccctgccctcctgctgactattcccgacttcatctttgccaacgtcagtgaggcagatgacagatatatctgtgaccgcttctaccccaatgacttgtgggtggttgtgttccagtttcagcacatcatggttggccttatcctgcctggtattgtcatcctgtcctgctattgcattatcatctccaagctgtcacactccaagggccaccagaagcgcaaggccctcaagaccacagtcatcctcatcctggctttcttcgcctgttggctgccttactacattgggatcagcatcgactccttcatcctcctggaaatcatcaagcaagggtgtgagtttgagaacactgtgcacaagtggatttccatcaccgaggccctagctttcttccactgttgtctgaaccccatcctctatgctttccttggagccaaatttaaaacctctgcccagcacgcactcacctctgtgagcagagggtccagcctcaagatcctctccaaaggaaagcgaggtggacattcatctgtttccactgagtctgagtcttcaagttttcactccagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - thioredoxin domain containing 15 - left-right determination factor 2 - TAR (HIV-1) RNA binding protein 2 - chemokine (C-X-C motif) receptor 3 |