Cart 2 Product Products 224,28 € (empty)
-
-
1 x NOSIP-nitr...121,50 €
No products
To be determined Shipping
224,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 224,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 224,28 €
Data sheet of LPAR2-lysophosphatidic acid receptor 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LPAR2-lysophosphatidic acid receptor 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025695 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LPAR2 |
| Origin species: | Human |
| Product name: | LPAR2-lysophosphatidic acid receptor 2 Gene |
| Size: | 2ug |
| Accessions: | BC025695 |
| Gene id: | 9170 |
| Gene description: | lysophosphatidic acid receptor 2 |
| Synonyms: | EDG-4; EDG4; LPA-2; LPA2; lysophosphatidic acid receptor 2; G protein-coupled receptor; LPA receptor 2; LPA receptor EDG4; endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 4; lysophosphatidic acid receptor EDG4; lysophosphatidic acid receptor Edg-4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcatcatgggccagtgctactacaacgagaccatcggcttcttctataacaacagtggcaaagagctcagctcccactggcggcccaaggatgtggtcgtggtggcactggggctgaccgtcagcgtgctggtgctgctgaccaatctgctggtcatagcagccatcgcctccaaccgccgcttccaccagcccatctactacctgctcggcaatctggccgcggctgacctcttcgcgggcgtggcctacctcttcctcatgttccacactggtccccgcacagcccgactttcacttgagggctggttcctgcggcagggcttgctggacacaagcctcactgcgtcggtggccacactgctggccatcgccgtggagcggcaccgcagtgtgatggccgtgcagctgcacagccgcctgccccgtggccgcgtggtcatgctcattgtgggcgtgtgggtggctgccctgggcctggggctgctgcctgcccactcctggcactgcctctgtgccctggaccgctgctcacgcatggcacccctgctcagccgctcctatttggccgtctgggctctgtcgagcctgcttgtcttcctgctcatggtggctgtgtacacccgcattttcttctacgtgcggcggcgagtgcagcgcatggcagagcatgtcagctgccacccccgctaccgagagaccacgctcagcctggtcaagactgttgtcatcatcctgggggcgttcgtggtctgctggacaccaggccaggtggtactgctcctggatggtttaggctgtgagtcctgcaatgtcctggctgtagaaaagtacttcctactgttggccgaggccaactcactggtcaatgctgctgtgtactcttgccgagatgctgagatgcgccgcaccttccgccgccttctctgctgcgcgtgcctccgccagtccacccgcgagtctgtccactatacatcctctgcccagggaggtgccagcactcgcatcatgcttcccgagaacggccacccactgatggactccaccctttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - PDZ and LIM domain 2 (mystique) - blood vessel epicardial substance - RAD23 homolog A (S. cerevisiae) - lysophosphatidic acid receptor 1 |