Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ST3GAL2-ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene
PTXBC036777
New product
Data sheet of ST3GAL2-ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ST3GAL2-ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC036777 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ST3GAL2 |
| Origin species: | Human |
| Product name: | ST3GAL2-ST3 beta-galactoside alpha-2,3-sialyltransferase 2 Gene |
| Size: | 2ug |
| Accessions: | BC036777 |
| Gene id: | 6483 |
| Gene description: | ST3 beta-galactoside alpha-2,3-sialyltransferase 2 |
| Synonyms: | Gal-NAc6S; SIAT4B; ST3GALII; ST3GalA.2; CMP-N-acetylneuraminate-beta-galactosamide-alpha-2,3-sialyltransferase 2; Gal-beta-1,3-GalNAc-alpha-2,3-sialyltransferase; SIAT4-B; ST3Gal II; alpha 2,3-ST 2; beta-galactoside alpha-2,3-sialyltransferase 2; sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase); ST3 beta-galactoside alpha-2,3-sialyltransferase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtgctccctgcgggtgtggttcctctccgtggccttcctgctggtgttcatcatgtccctgctcttcacctactcgcaccacagcatggccacgctcccctacctggactcaggggccctggatgggacgcaccgggtgaagctggtgcccggctatgccggcctgcagcgcctcagcaaggagaggctctcgggcaagagctgtgcctgtcgccgctgcatgggcgatgccggtgcctccgactggtttgacagccactttgacggtaacatttcccccgtctggacccgagagaacatggatcttccaccggacgtccagaggtggtggatgatgctgcagccccagttcaagtcacacaacaccaatgaggtgctggagaagctgttccagatagtgcctggcgagaacccctaccgcttccgggacccccaccagtgccggcgctgtgccgtggtggggaactcgggcaacctgcggggctctggctatgggcaggacgtggacgggcacaacttcatcatgaggatgaatcaggcgccaaccgtgggctttgagcaggatgttggcagccgaaccacccaccatttcatgtaccctgagagtgccaagaacctgcccgccaacgtcagcttcgtgctggtgcccttcaaggtcctggaccttctgtggatcgccagcgccttgtccacggggcagatccgattcacctacgccccagtgaagtccttccttcgagtggataaagaaaaggtccagatctacaacccagccttcttcaagtatatccacgacaggtggacagagcatcacgggcggtacccttccacggggatgctggtgcttttctttgccctgcatgtgtgtgatgaggtgaacgtgtacgggttcggggccgacagccggggcaactggcaccactactgggagaacaaccggtacgcgggcgagttccggaagactggcgtgcacgacgcggacttcgaggcccacatcatcgacatgctggccaaggccagcaagatcgaagtctaccggggcaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dynein, cytoplasmic 2, light intermediate chain 1 - fucosyltransferase 9 (alpha (1,3) fucosyltransferase) - translocation associated membrane protein 1-like 1 - aryl hydrocarbon receptor interacting protein-like 1 |