Cart 24 Product Products 3 110,14 € (empty)
-
1 x NFKBIE-nuc...121,50 € -
1 x ZFYVE26-zi...121,50 € -
1 x ZNF124-zin...121,50 € -
1 x Gas8...259,07 € -
1 x SOD1-super...113,40 € -
1 x P2RX4-puri...121,50 € -
1 x RBBP4-reti...121,50 € -
1 x LYPD5-LY6/...113,40 € -
1 x FANCA-Fanc...121,50 € -
1 x ZPBP-zona...121,50 € -
1 x DUSP26-dua...113,40 € -
1 x GCSH-glyci...113,40 € -
1 x PLEKHO2-pl...121,50 € -
1 x MMP13-matr...121,50 € -
1 x BST2-bone...113,40 € -
1 x SURF6-surf...121,50 € -
1 x RPS16-ribo...113,40 € -
1 x RPL13-ribo...113,40 € -
1 x RPSA-ribos...121,50 € -
1 x LRP3...259,07 € -
1 x DCI-dodece...113,40 € -
1 x GINS2-GINS...113,40 € -
1 x TUBA3E-tub...121,50 € -
1 x GBA3-gluco...113,40 €
No products
To be determined Shipping
3 110,14 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 24 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 110,14 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 110,14 €
Data sheet of TMEM66-transmembrane protein 66 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM66-transmembrane protein 66 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015012 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM66 |
| Origin species: | Human |
| Product name: | TMEM66-transmembrane protein 66 Gene |
| Size: | 2ug |
| Accessions: | BC015012 |
| Gene id: | 51669 |
| Gene description: | transmembrane protein 66 |
| Synonyms: | TMEM66; FOAP-7; HSPC035; XTP3; store-operated calcium entry-associated regulatory factor; HBV X-transactivated gene 3 protein; HBV XAg-transactivated protein 3; SARAF long isoform; SARAF short isoform; SOCE-associated regulatory factor; testicular secretory protein Li 59; transmembrane protein 66; store-operated calcium entry associated regulatory factor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgcagcctgcgggccgggagcggccgggtactgcttgctcctcggcttgcatttgtttctgctgaccgcgggccctgccctgggctggaacgaccctgacagaatgttgctgcgggatgtaaaagctcttaccctccactatgaccgctataccacctcccgcaggctggatcccatcccacagttgaaatgtgttggaggcacagctggttgtgattcttataccccaaaagtcatacagtgtcagaacaaaggctgggatgggtatgatgtacagtgggaatgtaagacggacttagatattgcatacaaatttggaaaaactgtggtgagctgtgaaggctatgagtcctctgaagaccagtatgtactaagaggttcttgtggcttggagtataatttagattatacagaacttggcctgcagaaactgaaggagtctggaaagcagcacggctttgcctctttctctgattattattataagtggtcctcggcggattcctgtaacatgagtggattgattaccatcgtggtactccttgggatcgcctttgtagtctataagctgttcctgagtgacgggcagtattctcctccaccgtactctgagtatcctccattttcccaccgttaccagagattcaccaactcagcaggacctcctcccccaggctttaagtctgagttcacaggaccacagaatactggccatggtgcaacttctggttttggcagtgcttttacaggacaacaaggatatgaaaattcaggaccagggttctggacaggcttgggaactggtggaatactaggatatttgtttggcagcaatagagcggcaacacccttctcagactcgtggtactacccgtcctatcctccctcctaccctggcacgtggaatagggcttactcaccccttcatggaggctcgggcagctattcggtatgttcaaactcagacacgaaaaccagaactgcatcaggatatggtggtaccaggagacgataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-acetylglucosamine kinase - N-acetylglucosamine kinase - tubulin folding cofactor C - HEAT repeat containing 1 |