Cart 144 Product Products 19 048,14 € (empty)
-
1 x UBC-ubiqui...121,50 € -
1 x CALML4-cal...113,40 € -
1 x Clusterin544,00 € -
1 x IGHG1-immu...121,50 € -
1 x RBM4-RNA...113,40 € -
1 x REG3G-rege...113,40 € -
-
1 x HLA-DRB5-m...121,50 € -
1 x TDGF1-tera...113,40 € -
1 x RETN-resis...113,40 € -
1 x TIPRL-TIP4...113,40 € -
1 x RWDD1-RWD...113,40 € -
1 x WNT7A-wing...121,50 € -
1 x LY6H-lymph...113,40 € -
1 x C15orf29-c...121,50 € -
1 x WDR90-WD...121,50 € -
1 x ANXA5-anne...121,50 € -
-
1 x CLIC1-chlo...113,40 € -
1 x NEDD9-neur...113,40 € -
1 x NR1H4-nucl...121,50 € -
-
1 x LigaTrap...284,64 € -
1 x CFHR3-comp...113,40 € -
1 x NEU2-siali...121,50 € -
-
1 x RICTOR-rap...113,40 € -
1 x RHAG-Rh-as...121,50 € -
1 x NEUROG1-ne...113,40 € -
1 x PSG2-pregn...121,50 € -
1 x PGLYRP3-pe...121,50 € -
1 x SRP9-signa...113,40 € -
1 x EP400NL-EP...121,50 € -
1 x ASPH-aspar...121,50 € -
1 x EMP3-epith...113,40 € -
1 x KLK15-kall...113,40 € -
-
1 x FAM49B-fam...121,50 € -
1 x WARS-trypt...121,50 € -
1 x WIT1-Wilms...113,40 € -
1 x RABL2A-RAB...113,40 € -
1 x MIF4GD-MIF...113,40 € -
1 x CMTM7-CKLF...113,40 € -
1 x OLIG3-olig...121,50 € -
1 x SLAMF6-SLA...121,50 € -
1 x C17orf87-c...113,40 € -
1 x SCLY-selen...121,50 € -
1 x DCP2-DCP2...121,50 € -
-
-
1 x MIF-macrop...113,40 € -
1 x GNB3-guani...121,50 € -
1 x CALM3-calm...113,40 € -
1 x CAPS2-calc...121,50 € -
1 x ODF2L-oute...113,40 € -
-
1 x HS2ST1-hep...113,40 € -
1 x ARPC5-acti...113,40 € -
-
1 x RPS7-ribos...113,40 € -
1 x DLEU1-dele...113,40 € -
-
-
1 x POLR1C-pol...121,50 € -
1 x KRCC1-lysi...113,40 € -
1 x PREB-prola...121,50 € -
1 x IL23A-inte...113,40 € -
1 x SPRY4-spro...121,50 € -
1 x RIN2-Ras...121,50 € -
-
1 x HLA-DRB1-m...121,50 € -
1 x RPAIN-RPA...113,40 € -
-
-
1 x TESC-tesca...113,40 € -
1 x MYADM-myel...121,50 € -
1 x β-Catenin...259,07 € -
1 x CCL3L3-che...113,40 € -
-
-
1 x CRABP1-cel...113,40 € -
1 x CORO2B-cor...121,50 € -
1 x AGER-advan...121,50 € -
1 x WISP3-WNT1...121,50 € -
1 x GCHFR-GTP...113,40 € -
-
-
-
1 x CYTH3-cyto...113,40 € -
1 x APOD-apoli...113,40 € -
1 x C6orf136-c...113,40 € -
1 x HLX-H2.0-l...121,50 € -
-
1 x SMOC1-SPAR...121,50 € -
1 x CYP39A1-cy...121,50 € -
1 x C3orf52-ch...113,40 € -
1 x CAMTA2-cal...113,40 € -
1 x CRBN-cereb...121,50 € -
1 x WDR89-WD...121,50 € -
1 x CRBN-cereb...121,50 € -
1 x CYP4X1...259,07 € -
-
1 x MDH2-malat...121,50 € -
1 x CMTM3-CKLF...113,40 € -
1 x SLC46A1-so...121,50 € -
1 x PTDSS1-pho...121,50 € -
1 x SHC1-SHC...121,50 € -
1 x EFEMP1-EGF...121,50 € -
1 x TLR6-toll-...121,50 € -
-
1 x ANTXR1-ant...121,50 € -
-
1 x MOCS3-moly...121,50 € -
1 x MPP3-membr...121,50 € -
1 x CCNK-cycli...121,50 € -
1 x TMEM174-tr...113,40 € -
1 x OPRS1-opio...113,40 € -
1 x WDR21C-WD...121,50 € -
-
-
1 x SLC35E4-so...121,50 € -
1 x ATP1B4-ATP...121,50 € -
1 x DYDC2-DPY3...113,40 € -
1 x IGLL1-immu...113,40 € -
1 x ANXA2-anne...121,50 € -
1 x WNT7B-wing...121,50 € -
-
1 x ATP5J-ATP...113,40 € -
1 x TRIM35-tri...113,40 € -
1 x ANKRD19-an...113,40 € -
-
1 x Arginase-L...544,00 € -
1 x ARMCX4-arm...121,50 € -
1 x HSPC152-hy...113,40 € -
1 x IRF9-inter...121,50 € -
1 x CASP2-casp...121,50 € -
1 x Olfactory...259,07 € -
-
1 x DTWD1-DTW...121,50 € -
1 x ZMYM3-zinc...121,50 € -
1 x CYP2B7P1-c...121,50 € -
1 x LOC204010-...113,40 € -
1 x DPH1-DPH1...121,50 € -
1 x NPM1-nucle...121,50 €
No products
To be determined Shipping
19 048,14 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 144 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 19 048,14 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 19 048,14 €
Data sheet of CENPN-centromere protein N Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CENPN-centromere protein N Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008972 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CENPN |
| Origin species: | Human |
| Product name: | CENPN-centromere protein N Gene |
| Size: | 2ug |
| Accessions: | BC008972 |
| Gene id: | 55839 |
| Gene description: | centromere protein N |
| Synonyms: | BM039; C16orf60; CENP-N; ICEN32; centromere protein N; interphase centromere complex protein 32 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatgagactgttgctgagttcatcaagaggaccatcttgaaaatccccatgaatgaactgacaacaatcctgaaggcctgggattttttgtctgaaaatcaactgcagactgtaaatttccgacagagaaaggaatctgtagttcagcacttgatccatctgtgtgaggaaaagcgtgcaagtatcagtgatgctgccctgttagacatcatttatatgcaatttcatcagcaccagaaagtttgggatgtttttcagatgagtaaaggaccaggtgaagatgttgacctttttgatatgaaacaatttaaaaattcgttcaagaaaattcttcagagagcattaaaaaatgtgacagtcagcttcagagaaactgaggagaatgcagtctggattcgaattgcctggggaacacagtacacaaagccaaaccagtacaaacctacctacgtggtgtactactcccagactccgtacgccttcacgtcctcctccatgctgaggcgcaatacaccgcttctgggtcaggcgctgacaattgctagcaaacaccatcagattgtgaaaatggacctgagaagtcggtatctggactctcttaaggctattgtttttaaacagtataatcagacctttgaaactcacaactctacgacacctctacaggaaagaagccttggactagatataaatatggattcaaggatcattcatgaaaacatagtagaaaaagagagagtccaacgaataactcaagaaacatttggagattatcctcaaccacaactagaatttgcacaatataagcttgaaacgaaattcaaaagtggtttaaatgggagcatcttggctgagagggaagaacccctccgatgcctaataaagttctctagcccacatcttctggaagcattgaaatccttagcaccagcgggtattgcagatgctccactttctccactgctcacttgcatacccaacaagagaatgaattattttaaaattagagataaat |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NDRG family member 4 - DMRT-like family C2 - synaptotagmin-like 2 - NCK adaptor protein 1 |