Cart 27 Product Products 3 518,27 € (empty)
-
-
1 x TRIP13-thy...121,50 € -
1 x ELOVL2-elo...121,50 € -
1 x NXPH4-neur...121,50 € -
1 x BIK-BCL2-i...113,40 € -
1 x HPRT1-hypo...113,40 € -
-
-
1 x GRPEL2-Grp...113,40 € -
1 x LENG1-leuk...113,40 € -
1 x UBL5-ubiqu...113,40 € -
1 x RPL23A-rib...113,40 € -
1 x ZNF266-zin...113,40 € -
1 x PGDS-prost...113,40 € -
1 x DLX6-dista...113,40 € -
-
1 x ANKRD22-an...113,40 € -
1 x SSSCA1-Sjo...113,40 € -
1 x SMAP2-smal...121,50 € -
1 x H2AFX-H2A...113,40 € -
1 x CRTAM-cyto...121,50 € -
1 x RPLP2-ribo...113,40 € -
-
1 x ORC4L-orig...113,40 € -
1 x RBPMS-RNA...113,40 € -
1 x MAP2K5-mit...121,50 € -
1 x HLA-DRB3-m...121,50 €
No products
To be determined Shipping
3 518,27 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 27 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 518,27 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 518,27 €
View larger 
Data sheet of ZFP36L1-zinc finger protein 36, C3H type-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZFP36L1-zinc finger protein 36, C3H type-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018340 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZFP36L1 |
| Origin species: | Human |
| Product name: | ZFP36L1-zinc finger protein 36, C3H type-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC018340 |
| Gene id: | 677 |
| Gene description: | zinc finger protein 36, C3H type-like 1 |
| Synonyms: | mRNA decay activator protein ZFP36L1; BRF1; Berg36; ERF-1; ERF1; RNF162B; TIS11B; cMG1; EGF-response factor 1; TPA-induced sequence 11b; ZFP36-like 1; butyrate response factor 1; early response factor Berg36; zinc finger protein 36, C3H type-like 1; zinc finger protein 36, C3H1 type-like 1; zinc finger protein, C3H type, 36-like 1; ZFP36 ring finger protein like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaccaccaccctcgtgtctgccaccatcttcgacttgagcgaagttttatgcaagggtaacaagatgctcaactatagtgctcccagtgcagggggttgcctgctggacagaaaggcagtgggcacccctgctggtgggggcttccctcggaggcactcagtcaccctgcccagctccaagttccaccagaaccagctcctcagcagcctcaagggtgagccagcccccgctctgagctcgcgagacagccgcttccgagaccgctccttctcggaagggggcgagcggctgctgcccacccagaagcagcccgggggcggccaggtcaactccagccgctacaagacggagctgtgccgcccctttgaggaaaacggtgcctgtaagtacggggacaagtgccagttcgcacacggcatccacgagctccgcagcctgacccgccaccccaagtacaagacggagctgtgccgcaccttccacaccatcggcttttgcccctacgggccccgctgccacttcatccacaacgctgaagagcgccgtgccctggccggggcccgggacctctccgctgaccgtccccgcctccagcatagctttagctttgctgggtttcccagtgccgctgccaccgccgctgccaccgggctgctggacagccccacgtccatcaccccaccccctattctgagcgccgatgacctcctgggctcacctaccctgcccgatggcaccaataacccttttgccttctccagccaggagctggcaagcctctttgcccctagcatggggctgcccgggggtggctccccgaccaccttcctcttccggcccatgtccgagtcccctcacatgtttgactctccccccagccctcaggattctctctcggaccaggagggctacctgagcagctccagcagcagccacagtggctcagactccccgaccttggacaactcaagacgcctgcccatcttcagcagactttccatctcagatgactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - non-SMC condensin II complex, subunit D3 - cAMP responsive element binding protein 1 - CD2 (cytoplasmic tail) binding protein 2 - sterile alpha motif domain containing 4A |