Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HIBCH-3-hydroxyisobutyryl-Coenzyme A hydrolase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIBCH-3-hydroxyisobutyryl-Coenzyme A hydrolase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005190 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIBCH |
| Origin species: | Human |
| Product name: | HIBCH-3-hydroxyisobutyryl-Coenzyme A hydrolase Gene |
| Size: | 2ug |
| Accessions: | BC005190 |
| Gene id: | 26275 |
| Gene description: | 3-hydroxyisobutyryl-Coenzyme A hydrolase |
| Synonyms: | HIBYLCOAH; 3-hydroxyisobutyryl-CoA hydrolase, mitochondrial; 3-hydroxyisobutyryl-Coenzyme A hydrolase; HIB-CoA hydrolase; HIBYL-CoA-H; testicular tissue protein Li 86; 3-hydroxyisobutyryl-CoA hydrolase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtggaggctcatgtcgaggtttaatgcattcaaaaggactaataccatactgcaccatttgagaatgtccaagcacacagatgcagcagaagaggtgctattggaaaaaaaaggttgcgcgggagtcataacactaaacagaccaaagttcctcaatgcactgactcttaatatgattcggcagatttatccacagctaaagaagtgggaacaagatcctgaaactttcctgatcattataaagggagcaggaggaaaggctttctgtgccgggggtgatatcagagtgatctcggaagctgaaaaggcaaaacagaagatagctccagttttcttcagagaagaatatatgctgaataatgctgttggttcttgccagaaaccttatgttgcacttattcatggaattacaatgggtgggggagttggtctctcagtccatgggcaatttcgagtggctacagaaaagtgtctttttgctatgccagaaactgcaataggactgttccctgatgtgggtggaggttatttcttgccacgactccaaggaaaacttggttacttccttgcattaacaggattcagactaaaaggaagagatgtgtacagagcaggaattgctacacactttgtagattctgaaaagttggccatgttagaggaagatttgttagccttgaaatctccttcaaaagaaaatattgcatctgtcttagaaaattaccatacagagtctaagattgatcgagacaagtcttttatacttgaggaacacatggacaaaataaacagttgtttttcagccaatactgtggaagaaattattgaaaacttacagcaagatggttcatcttttgccctagagcaattgaaggtaattaataaaatgtctccaacatctctaaagatcacactaaggcaactcatggaggggtcttcaaagaccttgcaagaagtactaactatggagtatcggctaagtcaagcttgtatgttttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium channel, subfamily K, member 1 - galactose mutarotase (aldose 1-epimerase) - armadillo repeat containing, X-linked 4 - hexamethylene bis-acetamide inducible 1 |