Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of EID3-EP300 interacting inhibitor of differentiation 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EID3-EP300 interacting inhibitor of differentiation 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027612 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EID3 |
| Origin species: | Human |
| Product name: | EID3-EP300 interacting inhibitor of differentiation 3 Gene |
| Size: | 2ug |
| Accessions: | BC027612 |
| Gene id: | 493861 |
| Gene description: | EP300 interacting inhibitor of differentiation 3 |
| Synonyms: | NS4EB; NSE4B; NSMCE4B; EP300-interacting inhibitor of differentiation 3; E1A-like inhibitor of differentiation 3; EID-1-like inhibitor of differentiation 3; EID-3; non-SMC element 4 homolog B; non-structural maintenance of chromosomes element 4 homolog B; testis tissue sperm-binding protein Li 96mP; EP300 interacting inhibitor of differentiation 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagatggatgtgtcagtgagggccgcgggctgctccgacgacctcagctctggggaggccgacgtagacccaaagctcctggagctcaccgctgacgaggagaagtgccgcagcatccgcaggcagtaccggcagctcatgtactgcgtgcggcagaaccgggaggacatcgtgagctcggcgaacaactccttaaccgaggctctggaggaagccaacgtcctctttgatggcgtgagccgaaccagagaagcagccctcgacgcccggtttcttgttatggcttctgatttgggtaaagaaaaggcaaagcagttaaactcagatatgaacttctttaatcagttagcattttgtgactttctgtttctgttcgtgggtctgaattggatggaaggcgatcctgacaagttgagtgattgtgatgatagcatagctctttccttctggaaggcaatagaaaaggaagcaacatcctggatggtaaaagctgagacattccattttgtttttggttcattcaagctagaacgttctgcaccaaagccccgacttgaacaccagaaaaaagttcgcaagatggaagaaaatggcaacatgcctacaaagttgcagaagttggacctgagtagttatccagaagcgacagaaaaaaacgtagaaaggattttgggattgttgcaaacctactttcgaaagtatcctgatactcctgtgtcctattttgagtttgtgattgatccaaactctttttctcgtactgtggagaatatattttatgtttcttttattgtaagagatggttttgcaagaataaggcttgatgaagacaggctgccaatattagagccgatgaatgttaaccaaatgggtgagggaaatgattccagttgccatggcaggaaacagggagttatatctttgactttacaggagtggaaaaacattgtggcagcttttgaaatttctgaggctatgattacatactcctcatactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aspartate beta-hydroxylase domain containing 2 - family with sequence similarity 118, member A - protein phosphatase 1K (PP2C domain containing) - 1-acylglycerol-3-phosphate O-acyltransferase 3 |