Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene
PTXBC001888
New product
Data sheet of PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001888 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPP1CA |
| Origin species: | Human |
| Product name: | PPP1CA-protein phosphatase 1, catalytic subunit, alpha isoform Gene |
| Size: | 2ug |
| Accessions: | BC001888 |
| Gene id: | 5499 |
| Gene description: | protein phosphatase 1, catalytic subunit, alpha isoform |
| Synonyms: | PP-1A; PP1A; PP1alpha; PPP1A; serine/threonine-protein phosphatase PP1-alpha catalytic subunit; protein phosphatase 1, catalytic subunit, alpha isoform; protein phosphatase 1, catalytic subunit, alpha isozyme; serine/threonine protein phosphatase PP1-alpha 1 catalytic subunit; testicular tissue protein Li 155; protein phosphatase 1 catalytic subunit alpha |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgacagcgagaagctcaacctggactcgatcatcgggcgcctgctggaagtgcagggctcgcggcctggcaagaatgtacagctgacagagaacgagatccgcggtctgtgcctgaaatcccgggagatttttctgagccagcccattcttctggagctggaggcacccctcaagatctgcggtgacatacacggccagtactacgaccttctgcgactatttgagtatggcggtttccctcccgagagcaactacctctttctgggggactatgtggacaggggcaagcagtccttggagaccatctgcctgctgctggcctataagatcaagtaccccgagaacttcttcctgctccgtgggaaccacgagtgtgccagcatcaaccgcatctatggtttctacgatgagtgcaagagacgctacaacatcaaactgtggaaaaccttcactgactgcttcaactgcctgcccatcgcggccatagtggacgaaaagatcttctgctgccacggaggcctgtccccggacctgcagtctatggagcagattcggcggatcatgcggcccacagatgtgcctgaccagggcctgctgtgtgacctgctgtggtctgaccctgacaaggacgtgcagggctggggcgagaacgaccgtggcgtctcttttacctttggagccgaggtggtggccaagttcctccacaagcacgacttggacctcatctgccgagcacaccaggtggtagaagacggctacgagttctttgccaagcggcagctggtgacacttttctcagctcccaactactgtggcgagtttgacaatgctggcgccatgatgagtgtggacgagaccctcatgtgctctttccagatcctcaagcccgccgacaagaacaaggggaagtacgggcagttcagtggcctgaaccctggaggccgacccatcaccccaccccgcaattccgccaaagccaagaaatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA (guanine-9-) methyltransferase domain containing 2 - synapse associated protein 1, SAP47 homolog (Drosophila) - protein phosphatase 1, regulatory (inhibitor) subunit 7 - GA binding protein transcription factor, beta subunit 1 |