Cart 22 Product Products 5 199,39 € (empty)
-
1 x ABCA9-ATP-...113,40 € -
1 x ABHD13-abh...113,40 € -
-
1 x AMIGO1-adh...121,50 € -
1 x FBLN7-fibu...121,50 € -
-
1 x CLEC7A-C-t...113,40 € -
1 x ABCA11P-AT...113,40 € -
1 x C1orf62-ch...121,50 € -
1 x ABCA3-ATP-...113,40 € -
-
-
-
1 x ABT1-activ...121,50 € -
1 x Histone H3...259,07 € -
-
-
1 x Training Kit224,00 € -
-
1 x CFHR3-comp...121,50 € -
-
No products
To be determined Shipping
5 199,39 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 199,39 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 199,39 €
View larger 
Data sheet of PHYHIP-phytanoyl-CoA 2-hydroxylase interacting protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PHYHIP-phytanoyl-CoA 2-hydroxylase interacting protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034034 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PHYHIP |
| Origin species: | Human |
| Product name: | PHYHIP-phytanoyl-CoA 2-hydroxylase interacting protein Gene |
| Size: | 2ug |
| Accessions: | BC034034 |
| Gene id: | 9796 |
| Gene description: | phytanoyl-CoA 2-hydroxylase interacting protein |
| Synonyms: | DYRK1AP3; PAHX-AP; PAHXAP1; phytanoyl-CoA hydroxylase-interacting protein; DYRK1A interacting protein 3; PAHX-AP1; phytanoyl-CoA alpha-hydroxylase associated protein; phytanoyl-CoA hydroxylase-associated protein 1; phytanoyl-CoA 2-hydroxylase interacting protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagctgctgtccacgccccacagcattgagatcaacaacatcacctgcgactccttcagcatctcctgggccatggaggacagtgacctggagagggtcacccattacttcattgaccttaacaagaaggagaataagaattccaacaagttcaagcaccgggacgtccccaccaagctcgtggccaaggcagtgccgctgcccatgacggtgagaggccactggttcctgagcccccgcacggagtacagtgtggccgtgcagacggcagtgaagcagagcgatggggagtacctggtgtccggctggagcgagacggtggagttctgcactggggattatgccaaggagcacctggctcagcttcaggagaaagctgagcagatcgcaggccgcatgctccgcttctccgtcttctaccgcaaccatcacaaggagtacttcgagcatgccaggacccactgcgggaacatgctgcagccttacctgaaggacaacagcggcagccacggctcccccaccagcggtatgctccacggggtcttcttcagctgcaacacggagttcaacacgggccagcccccgcaggactccccctacggccgctggcgcttccagatcccagctcagcgcctcttcaatcccagcaccaacctctactttgcggacttctactgcatgtacacggcctaccactacgccatcctggtgctggcgcccaaaggctccatgggggaccgcttctgccgcgaccgccggcccctcctggacattgcttgcaacaagttcctgacctgcagcgtggaggatggggagctggtcttccgccacgcccaggacctcatcctggagatcatctacactgagcccgtcgacctgtccctgggcaccctgggggagatcagtgggcaccagctcatgagtctgtctactgccgatgccaagaaggaccccagctgcaagacctgcaacatcagcgtgggccgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - electron-transfer-flavoprotein, alpha polypeptide - hairy/enhancer-of-split related with YRPW motif 2 - protein kinase, cAMP-dependent, catalytic, beta - branched chain aminotransferase 2, mitochondrial |