Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
AKR7A2-aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) Gene
PTXBC004111
New product
Data sheet of AKR7A2-aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AKR7A2-aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004111 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AKR7A2 |
| Origin species: | Human |
| Product name: | AKR7A2-aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) Gene |
| Size: | 2ug |
| Accessions: | BC004111 |
| Gene id: | 8574 |
| Gene description: | aldo-keto reductase family 7, member A2 (aflatoxin aldehyde reductase) |
| Synonyms: | AFAR; AFAR1; AFB1-AR1; AKR7; aflatoxin B1 aldehyde reductase member 2; AFB1 aldehyde reductase 1; AFB1-AR 1; HEL-S-166mP; SSA reductase; aflatoxin aldehyde reductase; aflatoxin beta1 aldehyde reductase; aldoketoreductase 7; epididymis secretory sperm binding protein Li 166mP; succinic semialdehyde reductase; aldo-keto reductase family 7 member A2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccggccaccgccaccgcgggtcgcctcggtgctgggcaccatggagatggggcgccgcatggacgcgcccgccagcgccgcggccgtgcgcgcctttctggagcgcggccacaccgaactggacacggccttcatgtacagcgacggccagtccgagaccatcctgggcggcctggggctcgggctgggcggtggcgactgcagagtgaaaattgccaccaaggccaacccttgggatggaaaatcactaaagcctgacagtgtccggtcccagctggagacgtcattgaagaggctgcagtgtccccaagtggacctcttctacctacacgcacctgaccacggcaccccggtggaagagacgctgcatgcctgccagcggctgcaccaggagggcaagttcgtggagcttggcctctccaactatgctagctgggaagtggccgagatctgtaccctctgcaagagcaatggctggatcctgcccactgtgtaccagggcatgtacaacgccaccacccggcaggtggaaacggagctcttcccctgcctcaggcactttggactgaggttctatgcctacaaccctctggctgggggcctgctgactggcaagtacaagtatgaggacaaggacgggaaacagcctgtgggccgcttctttgggaatagctgggctgagacctacaggaatcgcttctggaaggagcaccacttcgaggccattgcgttggtggagaaggccctgcaggccgcatatggcgccagcgcccccagtgtgacctcggctgccctccggtggatgtaccaccactcacagctgcagggtgcccacggggacgcggtcatcctgggcatgtccagcctggagcagctggagcagaacttggcagcaacagaggaagggcccctggagccggctgtcgtggatgcctttaatcaagcctggcatttggttgctcacgaatgtcccaactacttccgctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aldo-keto reductase family 7, member A3 (aflatoxin aldehyde reductase) - sperm adhesion molecule 1 (PH-20 hyaluronidase, zona pellucida binding) - cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant - eukaryotic translation initiation factor 4E nuclear import factor 1 |