Cart 8 Product Products 931,50 € (empty)
-
1 x PSMC2-prot...121,50 € -
1 x NUDT2-nudi...113,40 € -
1 x LMAN2L-lec...121,50 € -
1 x C7orf49-ch...113,40 € -
1 x GLO1-glyox...113,40 € -
1 x DUT-deoxyu...113,40 € -
1 x C1orf123-c...113,40 € -
1 x CD200R1-CD...121,50 €
No products
To be determined Shipping
931,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 8 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 931,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 931,50 €
Data sheet of GPR3-G protein-coupled receptor 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR3-G protein-coupled receptor 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032702 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR3 |
| Origin species: | Human |
| Product name: | GPR3-G protein-coupled receptor 3 Gene |
| Size: | 2ug |
| Accessions: | BC032702 |
| Gene id: | 2827 |
| Gene description: | G protein-coupled receptor 3 |
| Synonyms: | ACCA; G-protein coupled receptor 3; ACCA orphan receptor; adenylate cyclase constitutive activator; G protein-coupled receptor 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgtggggtgcaggcagccctctggcctggctctcagctggctcaggcaacgtgaatgtaagcagcgtgggcccagcagaggggcccacaggtccagccgcaccactgccctcgcctaaggcctgggatgtggtgctctgcatctcaggcaccctggtgtcctgcgagaatgcgctagtggtggccatcatcgtgggcactcctgccttccgtgcccccatgttcctgctggtgggcagcctggccgtggcagacctgctggcaggcctgggcctggtcctgcactttgctgctgtcttctgcatcggctcagcggagatgagcctggtgctggttggcgtgctggcaatggcctttaccgccagcatcggcagtctactggccatcactgtcgaccgctacctttctctgtacaatgccctcacctactattcagagacaacagtgacacggacctatgtgatgctggccttagtgtggggaggtgccctgggcctggggctgctgcctgtgctggcctggaactgcctggatggcctgaccacatgtggcgtggtttatccactctccaagaaccatctggtagttctggccattgccttcttcatggtgtttggcatcatgctgcagctctacgcccaaatctgccgcatcgtctgccgccatgcccagcagattgcccttcagcggcacctgctgcctgcctcccactatgtggccacccgcaagggcattgccacactggccgtggtgcttggagcctttgccgcctgctggttgcccttcactgtctactgcctgctgggtgatgcccactctccacctctctacacctatcttaccttgctccctgccacctacaactccatgatcaaccctatcatctacgccttccgcaaccaggatgtgcagaaagtgctgtgggctgtctgctgctgctgttcctcttccaagatccccttccgatcccgctcccccagtgatgtctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ER lipid raft associated 1 - transmembrane protein 115 - tropomodulin 3 (ubiquitous) - SERTA domain containing 4 |