Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GRAP2-GRB2-related adaptor protein 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GRAP2-GRB2-related adaptor protein 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025692 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GRAP2 |
| Origin species: | Human |
| Product name: | GRAP2-GRB2-related adaptor protein 2 Gene |
| Size: | 2ug |
| Accessions: | BC025692 |
| Gene id: | 9402 |
| Gene description: | GRB2-related adaptor protein 2 |
| Synonyms: | GADS; GRAP-2; GRB2L; GRBLG; GRID; GRPL; GrbX; Grf40; Mona; P38; GRB2-related adapter protein 2; GRB-2-like protein; GRB2-related protein with insert domain; SH3-SH2-SH3 adapter Mona; SH3-SH2-SH3 adaptor molecule; adapter protein GRID; grf-40; grf40 adapter protein; growth factor receptor-binding protein; growth factor receptor-bound protein 2-related adaptor protein 2; hematopoietic cell-associated adapter protein GrpL; hematopoietic cell-associated adaptor protein GRPL; GRB2-related adaptor protein 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagctgttgccaagtttgatttcactgcttcaggtgaggatgaactgagctttcacactggagatgttttgaagattttaagtaaccaagaggagtggtttaaggcggagcttgggagccaggaaggatatgtgcccaagaatttcatagacatccagtttcccaaatggtttcacgaaggcctctctcgacaccaggcagagaacttactcatgggcaaggaggttggcttcttcatcatccgggccagccagagctccccaggggacttctccatctctgtcaggcatgaggatgacgttcaacacttcaaggtcatgcgagacaacaagggtaattactttctgtggactgagaagtttccatccctaaataagctggtagactactacaggacaaattccatctccagacagaagcagatcttccttagagacagaacccgagaagaccagggtcaccggggcaacagcctggaccggaggtcccagggaggcccacacctcagtggggctgtgggagaagaaatccgaccttcgatgaaccggaagctgtcggatcaccccccgacccttcccctgcagcagcaccagcaccagccacagcctccgcaatatgccccagcgccccagcagctgcagcagcccccacagcagcgatatctgcagcaccaccatttccaccaggaacgccgaggaggcagccttgacataaatgatgggcattgtggcaccggcttgggcagtgaaatgaatgcggccctcatgcatcggagacacacagacccagtgcagctccaggcggcagggcgagtgcggtgggcccgggcgctgtatgactttgaggccctggaggatgacgagctggggttccacagcggggaggtggtggaggtcctggatagctccaacccatcctggtggaccggccgcctgcacaacaagctgggcctcttccctgccaactacgtggcacccatgacccgataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - neurogenic differentiation 6 - islet cell autoantigen 1, 69kDa - filamin binding LIM protein 1 - dual specificity phosphatase 6 |