Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ZFP36-zinc finger protein 36, C3H type, homolog (mouse) Gene
PTXBC009693
New product
Data sheet of ZFP36-zinc finger protein 36, C3H type, homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZFP36-zinc finger protein 36, C3H type, homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009693 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZFP36 |
| Origin species: | Human |
| Product name: | ZFP36-zinc finger protein 36, C3H type, homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC009693 |
| Gene id: | 7538 |
| Gene description: | zinc finger protein 36, C3H type, homolog (mouse) |
| Synonyms: | ZFP36 ring finger protein; mRNA decay activator protein ZFP36; G0S24; GOS24; NUP475; RNF162A; TIS11; TTP; zfp-36; G0/G1 switch regulatory protein 24; growth factor-inducible nuclear protein NUP475; tristetraproline; zinc finger protein 36 homolog; zinc finger protein 36, C3H type, homolog; zinc finger protein, C3H type, 36 homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatctgactgccatctacgagagcctcctgtcgctgagccctgacgtgcccgtgccatccgaccatggagggactgagtccagcccaggctggggctcctcgggaccctggagcctgagcccctccgactccagcccgtctggggtcacctcccgcctgcctggccgctccaccagcctagtggagggccgcagctgtggctgggtgcccccaccccctggcttcgcaccgctggctccccgcctgggccctgagctgtcaccctcacccacttcgcccactgcaacctccaccaccccctcgcgctacaagactgagctatgtcggaccttctcagagagtgggcgctgccgctacggggccaagtgccagtttgcccatggcctgggcgagctgcgccaggccaatcgccaccccaaatacaagacggaactctgtcacaagttctacctccagggccgctgcccctacggctctcgctgccacttcatccacaaccctagcgaagacctggcggccccgggccaccctcctgtgcttcgccagagcatcagcttctccggcctgccctctggccgccggacctcaccaccaccaccaggcctggccggcccttccctgtcctccagctccttctcgccctccagctccccaccaccacctggggaccttccactgtcaccctctgccttctctgctgcccctggcacccccctggctcgaagagaccccaccccagtctgttgcccctcctgccgaagggccactcctatcagcgtctgggggcccttgggtggcctggttcggaccccctctgtacagtccctgggatccgaccctgatgaatatgccagcagcggcagcagcctggggggctctgactctcccgtcttcgaggcgggagtttttgcaccaccccagcccgtggcagccccccggcgactccccatcttcaatcgcatctctgtttctgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - WW domain containing E3 ubiquitin protein ligase 2 - vacuolar protein sorting 26 homolog B (S. pombe) - protein kinase, cAMP-dependent, catalytic, gamma - family with sequence similarity 108, member A1 |