Cart 12 Product Products 1 639,85 € (empty)
-
1 x C2orf76-ch...113,40 € -
1 x BCL7C-B-ce...113,40 € -
-
1 x C6orf208-c...113,40 € -
1 x FDC-SP...259,07 € -
-
-
1 x C19orf60-c...113,40 € -
1 x C15orf15-c...113,40 € -
1 x C3orf10-ch...113,40 € -
-
No products
To be determined Shipping
1 639,85 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 639,85 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 639,85 €
View larger 
SLC25A22-solute carrier family 25 (mitochondrial carrier: glutamate), member 22 Gene
PTXBC019033
New product
Data sheet of SLC25A22-solute carrier family 25 (mitochondrial carrier: glutamate), member 22 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A22-solute carrier family 25 (mitochondrial carrier: glutamate), member 22 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019033 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A22 |
| Origin species: | Human |
| Product name: | SLC25A22-solute carrier family 25 (mitochondrial carrier: glutamate), member 22 Gene |
| Size: | 2ug |
| Accessions: | BC019033 |
| Gene id: | 79751 |
| Gene description: | solute carrier family 25 (mitochondrial carrier: glutamate), member 22 |
| Synonyms: | EIEE3; GC-1; GC1; NET44; mitochondrial glutamate carrier 1; glutamate/H(+) symporter 1; solute carrier family 25 (mitochondrial carrier: glutamate), member 22; solute carrier family 25 member 22 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgataagcagatcagcctgccagccaagctcatcaatggcggcatcgccgggctgatcggtgtcacctgcgtgtttcccatcgacctggccaagaccaggctgcagaaccagcagaacggccagcgcgtgtacacgagcatgtccgactgcctcatcaagaccgtccgctccgagggctacttcggcatgtaccggggagctgctgtgaacttgaccctcgtcacccccgagaaggccatcaagctggcagccaacgacttcttccgacatcagctctctaaggacgggcagaagctgaccctgcttaaagagatgctggcgggctgtggggctggcacctgccaggtgatcgtgaccacgcccatggagatgctgaagatccagctgcaggatgcagggcgcattgccgcccagaggaagatcctggctgcccagggccagctctcggcccaggggggtgcccagccctcagtggaggctccagctgcccctcggcccacggccacccagctgacccgcgacctgctgcggagccgtggcattgccggtctctacaagggactcggggccacgctgctcagggatgtccccttctctgtggtgtacttcccgctctttgccaacctgaaccagctgggccgcccggcgtccgaggagaagtcgcctttctacgtgtccttcctggccggctgtgtggctgggagtgccgccgctgtggccgtcaacccctgtgatgtggtgaagacgcggctccagtcacttcagcgaggcgtcaacgaggacacctactctgggatcctggactgtgccaggaagatcctgcggcacgagggcccctcggccttcctgaagggcgcctactgccgcgcgctggtcatcgcgccccttttcggcatcgcacaggtggtctacttcctgggcatcgcggagtccctgctggggctgctgcaggacccccaggcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform - phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III - potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2 - potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3 |