Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT18-nudix (nucleoside diphosphate linked moiety X)-type motif 18 Gene
PTXBC016902
New product
Data sheet of NUDT18-nudix (nucleoside diphosphate linked moiety X)-type motif 18 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT18-nudix (nucleoside diphosphate linked moiety X)-type motif 18 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016902 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT18 |
| Origin species: | Human |
| Product name: | NUDT18-nudix (nucleoside diphosphate linked moiety X)-type motif 18 Gene |
| Size: | 2ug |
| Accessions: | BC016902 |
| Gene id: | 79873 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 18 |
| Synonyms: | 8-oxo-dGDP phosphatase NUDT18; MTH3; 2-hydroxy-dADP phosphatase; 7,8-dihydro-8-oxoguanine phosphatase; mutT homolog 3; mutT human homolog 3; nucleoside diphosphate-linked moiety X motif 18; nudix (nucleoside diphosphate linked moiety X)-type motif 18; nudix motif 18; nudix hydrolase 18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcctcggagggcctggcgggggcgctggcttccgtgctggctggccaggggtccagcgtgcacagctgcgactcggcgccggccggggagccgccggcgcccgtgcggctgcggaagaacgtgtgctacgtggtgctggccgtgttcctcagcgagcaggatgaggtgctactgatccaggaggccaagagggagtgccgggggtcgtggtacctgcctgcggggagaatggagccaggggagaccatcgtggaggcgctgcagcgggaggtgaaggaggaggcggggctgcactgtgagcccgagacactgctgtccgtggaggagcggggcccctcctgggtccgcttcgtgttcctcgctcgccccacaggtggaattctcaagacttccaaggaggccgatgcggagtccctgcaggctgcctggtacccacggacctccctgcccactccgctgcgagcccatgacatcctgcacctggttgaactagccgcccagtatcgccagcaagccaggcaccctctcattctgccccaagagctaccctgtgatctggtctgccagcggctcgtggctacctttaccagcgcccagacagtgtgggtgttagtgggcacagtggggatgcctcacttgcctgtcactgcctgtggcctcgaccctatggagcagaggggtggcatgaagatggccgtcctgcggctgctgcaggagtgtctgaccctgcaccacttggtggtggagatcaaggggttgcttggactgcagcacctgggccgagatcacagtgatggcatctgtttgaatgtgctggtgaccgtggcttttcggagcccagggatccaggatgaacccccaaaagttcggggtgagaacttctcttggtggaaggtgatggaggaagacctgcaaagccagctcctccagcggcttcagggatcctctgttgtcccagtgaacagatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - aldo-keto reductase family 1, member A1 (aldehyde reductase) - beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) - nudE nuclear distribution gene E homolog (A. nidulans)-like 1 - arsA arsenite transporter, ATP-binding, homolog 1 (bacterial) |