Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FCER2-Fc fragment of IgE, low affinity II, receptor for (CD23) Gene
PTXBC014108
New product
Data sheet of FCER2-Fc fragment of IgE, low affinity II, receptor for (CD23) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FCER2-Fc fragment of IgE, low affinity II, receptor for (CD23) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014108 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FCER2 |
| Origin species: | Human |
| Product name: | FCER2-Fc fragment of IgE, low affinity II, receptor for (CD23) Gene |
| Size: | 2ug |
| Accessions: | BC014108 |
| Gene id: | 2208 |
| Gene description: | Fc fragment of IgE, low affinity II, receptor for (CD23) |
| Synonyms: | BLAST-2; CD23A; CLEC4J; FCE2; IGEBF; low affinity immunoglobulin epsilon Fc receptor; C-type lectin domain family 4, member J; CD23 antigen; Fc epsilon receptor II; Fc fragment of IgE, low affinity II, receptor for (CD23); fc-epsilon-RII; immunoglobulin E-binding factor; immunoglobulin epsilon-chain; lymphocyte IgE receptor; Fc fragment of IgE receptor II |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggaaggtcaatattcagagatcgaggagcttcccaggaggcggtgttgcaggcgtgggactcagatcgtgctgctggggctggtgaccgccgctctgtgggctgggctgctgactctgcttctcctgtggcactgggacaccacacagagtctaaaacagctggaagagagggctgcccggaacgtctctcaagtttccaagaacttggaaagccaccacggtgaccagatggcgcagaaatcccagtccacgcagatttcacaggaactggaggaacttcgagctgaacagcagagattgaaatctcaggacttggagctgtcctggaacctgaacgggcttcaagcagatctgagcagcttcaagtcccaggaattgaacgagaggaacgaagcttcagatttgctggaaagactccgggaggaggtgacaaagctaaggatggagttgcaggtgtccagcggctttgtgtgcaacacgtgccctgaaaagtggatcaatttccaacggaagtgctactacttcggcaagggcaccaagcagtgggtccacgcccggtatgcctgtgacgacatggaagggcagctggtcagcatccacagcccggaggagcaggacttcctgaccaagcatgccagccacaccggctcctggattggccttcggaacttggacctgaagggggagtttatctgggtggatgggagccacgtggactacagcaactgggctccaggggagcccaccagccggagccagggcgaggactgcgtgatgatgcggggctccggtcgctggaacgacgccttctgcgaccgtaagctgggcgcctgggtgtgcgaccggctggccacatgcacgccgccagccagcgaaggttccgcggagtccatgggacctgattcaagaccagaccctgacggccgcctgcccaccccctctgcccctctccactcttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 1, catalytic subunit, alpha isoform - RNA (guanine-9-) methyltransferase domain containing 2 - synapse associated protein 1, SAP47 homolog (Drosophila) - protein phosphatase 1, regulatory (inhibitor) subunit 7 |