Cart 11 Product Products 1 507,56 € (empty)
-
1 x C3orf37-ch...121,50 € -
1 x CRYBA4-cry...113,40 € -
1 x TMEM184A-t...121,50 € -
1 x RWDD2A-RWD...121,50 € -
1 x UBA6-ubiqu...121,50 € -
1 x KIAA1305-K...113,40 € -
-
1 x HMGB4-high...113,40 € -
1 x TMEM44-tra...113,40 € -
1 x TNFRSF14-t...121,50 € -
1 x TFB2M-tran...121,50 €
No products
To be determined Shipping
1 507,56 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 507,56 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 507,56 €
Data sheet of RPLP0-ribosomal protein, large, P0 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPLP0-ribosomal protein, large, P0 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000087 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPLP0 |
| Origin species: | Human |
| Product name: | RPLP0-ribosomal protein, large, P0 Gene |
| Size: | 2ug |
| Accessions: | BC000087 |
| Gene id: | 6175 |
| Gene description: | ribosomal protein, large, P0 |
| Synonyms: | L10E; LP0; PRLP0; RPP0; 60S acidic ribosomal protein P0; 60S ribosomal protein L10E; acidic ribosomal phosphoprotein P0; neutral ribosomal phosphoprotein P0; ribosomal protein, large, P0; ribosomal protein lateral stalk subunit P0 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccagggaagacagggcgacctggaagtccaactacttccttaagatcatccaactattggatgattatccgaaatgtttcattgtgggagcagacaatgtgggctccaagcagatgcagcagatccgcatgtcccttcgcgggaaggctgtggtgctgatgggcaagaacaccatgatgcgcaaggccatccgagggcacctggaaaacaacccagctctggagaaactgctgcctcatatccgggggaatgtgggctttgtgttcaccaaggaggacctcactgagatcagggacatgttgctggccaataaggtgccagctgctgcccgtgctggtgccattgccccatgtgaagtcactgtgccagcccagaacactggtctcgggcccgagaagacctcctttttccaggctttaggtatcaccactaaaatctccaggggcaccattgaaatcctgagtgatgtgcagctgatcaagactggagacaaagtgggagccagcgaagccacgctgctgaacatgctcaacatctcccccttctcctttgggctggtcatccagcaggtgttcgacaatggcagcatctacaaccctgaagtgcttgatatcacagaggaaactctgcattctcgcttcctggagggtgtccgcaatgttgccagtgtctgtctgcagattggctacccaactgttgcatcagtaccccattctatcatcaacgggtacaaacgagtcctggccttgtctgtggagacggattacaccttcccacttgctgaaaaggtcaaggccttcttggctgatccatctgcctttgtggctgctgcccctgtggctgctgccaccacagctgctcctgctgctgctgcagccccagctaaggttgaagccaaggaagagtcggaggagtcggacgaggatatgggatttggtctctttgactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein, large, P0 - steroid 5 alpha-reductase 3 - Rho GTPase-activating protein - fructose-1,6-bisphosphatase 1 |