Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
AKR1B10-aldo-keto reductase family 1, member B10 (aldose reductase) Gene
PTXBC008837
New product
Data sheet of AKR1B10-aldo-keto reductase family 1, member B10 (aldose reductase) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AKR1B10-aldo-keto reductase family 1, member B10 (aldose reductase) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008837 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AKR1B10 |
| Origin species: | Human |
| Product name: | AKR1B10-aldo-keto reductase family 1, member B10 (aldose reductase) Gene |
| Size: | 2ug |
| Accessions: | BC008837 |
| Gene id: | 57016 |
| Gene description: | aldo-keto reductase family 1, member B10 (aldose reductase) |
| Synonyms: | AKR1B11; AKR1B12; ALDRLn; ARL-1; ARL1; HIS; HSI; aldo-keto reductase family 1 member B10; ARP; SI reductase; aldo-keto reductase family 1, member B10 (aldose reductase); aldo-keto reductase family 1, member B11 (aldose reductase-like); aldose reductase-like 1; aldose reductase-like peptide; aldose reductase-related protein; hARP; small intestine reductase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccacgtttgtggagctcagtaccaaagccaagatgcccattgtgggcctgggcacttggaagtctcctcttggcaaagtgaaagaagcagtgaaggtggccattgatgcaggatatcggcacattgactgtgcctatgtctatcagaatgaacatgaagtgggggaagccatccaagagaagatccaagagaaggctgtgaagcgggaggacctgttcatcgtcagcaagttgtggcccactttctttgagagaccccttgtgaggaaagcctttgagaagaccctcaaggacctgaagctgagctatctggacgtctatcttattcactggccacagggattcaagtctggggatgaccttttccccaaagatgataaaggtaatgccatcggtggaaaagcaacgttcttggatgcctgggaggccatggaggagctggtggatgaggggctggtgaaagcccttggggtctccaatttcagccacttccagatcgagaagctcttgaacaaacctggactgaaatataaaccagtgactaaccaggttgagtgtcacccatacctcacacaggagaaactgatccagtactgccactccaagggcatcaccgttacggcctacagccccctgggctctccggatagaccttgggccaagccagaagacccttccctgctggaggatcccaagattaaggagattgctgcaaagcacaaaaaaaccgcagcccaggttctgatccgtttccatatccagaggaatgtgattgtcatccccaagtctgtgacaccagcacgcattgttgagaacattcaggtctttgactttaaattgagtgatgaggagatggcaaccatactcagcttcaacagaaactggagggcctgtaacgtgttgcaatcctctcatttggaagactatcccttcgatgcagaatattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nudix (nucleoside diphosphate linked moiety X)-type motif 18 - aldo-keto reductase family 1, member A1 (aldehyde reductase) - beta-1,3-glucuronyltransferase 3 (glucuronosyltransferase I) - nudE nuclear distribution gene E homolog (A. nidulans)-like 1 |