Cart 1 Product Products 353,90 € (empty)
No products
To be determined Shipping
353,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 353,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 353,90 €
View larger 
SLC25A18-solute carrier family 25 (mitochondrial carrier), member 18 Gene
PTXBC031644
New product
Data sheet of SLC25A18-solute carrier family 25 (mitochondrial carrier), member 18 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A18-solute carrier family 25 (mitochondrial carrier), member 18 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC031644 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A18 |
| Origin species: | Human |
| Product name: | SLC25A18-solute carrier family 25 (mitochondrial carrier), member 18 Gene |
| Size: | 2ug |
| Accessions: | BC031644 |
| Gene id: | 83733 |
| Gene description: | solute carrier family 25 (mitochondrial carrier), member 18 |
| Synonyms: | GC2; mitochondrial glutamate carrier 2; glutamate/H(+) symporter 2; solute carrier family 25 (glutamate carrier), member 18; solute carrier family 25 (mitochondrial carrier), member 18; solute carrier family 25 member 18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacccaccaggatctgagcatcacagccaaactcatcaatggaggtgtagcagggctcgtgggggtgacctgcgtgttccccatcgacttggccaagactcgcctgcagaaccagcatgggaaagccatgtacaaaggaatgatcgactgcctgatgaagacggctcgggcggagggcttcttcggcatgtaccgaggggctgcagtgaacctcactctggtcactccagagaaggccatcaagctggcggccaacgactttttccggcggctgctcatggaagatgggatgcagcggaacctgaagatggagatgcttgccgggtgtggggctgggatgtgccaggtcgtggtgacctgtcccatggaaatgctcaagattcagctgcaggatgctggacgcctggccgtccatcatcagggctcggcctcagcaccctccacctccaggtcctacacaactggttcggcttccacccacaggcgcccctctgccaccctcattgcctgggagctgctccgcactcagggcctggctgggctctacaggggcctgggtgccactctcctcagagacattcctttctccatcatctacttcccactgtttgccaaccttaacaacctggggttcaacgagctcgccggtaaggcgtcctttgcacattccttcgtgtcaggctgtgtggcaggttccatagctgcggtcgcagtgacgcctctagatgttctgaaaactcgaatccaaaccctcaagaaaggcctgggcgaggacatgtacagtgggatcaccgactgtgccaggaaactctggattcaggagggaccatctgccttcatgaaaggcgctggctgccgggcactggtcatagcacctctctttgggattgctcaaggggtctattttattgggattggagagcgcatcttaaagtgttttgactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor, alpha-induced protein 1 (endothelial) - solute carrier family 29 (nucleoside transporters), member 2 - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 - potassium inwardly-rectifying channel, subfamily J, member 10 |