Cart 12 Product Products 1 336,74 € (empty)
-
-
1 x PTGR2-pros...121,50 € -
-
1 x PDCL3-phos...113,40 € -
1 x OR10H1-olf...121,50 € -
1 x YIPF2-Yip1...121,50 € -
-
1 x MAPKSP1-MA...113,40 € -
1 x BID-BH3...113,40 € -
1 x CD244-CD24...121,50 € -
1 x PAPLN-papi...113,40 € -
No products
To be determined Shipping
1 336,74 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 12 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 336,74 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 336,74 €
View larger 
SLC25A11-solute carrier family 25 (mitochondrial carrier, oxoglutarate carrier), member 11 Gene
PTXBC006508
New product
Data sheet of SLC25A11-solute carrier family 25 (mitochondrial carrier, oxoglutarate carrier), member 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A11-solute carrier family 25 (mitochondrial carrier, oxoglutarate carrier), member 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006508 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A11 |
| Origin species: | Human |
| Product name: | SLC25A11-solute carrier family 25 (mitochondrial carrier, oxoglutarate carrier), member 11 Gene |
| Size: | 2ug |
| Accessions: | BC006508 |
| Gene id: | 8402 |
| Gene description: | solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11 |
| Synonyms: | OGC; SLC20A4; mitochondrial 2-oxoglutarate/malate carrier protein; OGCP; solute carrier family 20 (oxoglutarate carrier), member 4; solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11; solute carrier family 25 member 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgacggcgagtgccggggccggcgggatagacgggaagccccgtacctcccctaagtccgtcaagttcctgtttgggggcctggccgggatgggagctacagtttttgtccagcccctggacctggtgaagaaccggatgcagttgagcggggaaggggccaagactcgagagtacaaaaccagcttccatgccctcaccagtatcctgaaggcagaaggcctgaggggcatttacactgggctgtcggctggcctgctgcgtcaggccacctacaccactacccgccttggcatctataccgtgctgtttgagcgcctgactggggctgatggtactccccctggctttctgctgaaggctgtgattggcatgaccgcaggtgccactggtgcctttgtgggaacaccagccgaagtggctcttatccgcatgactgccgatggccggcttccagctgaccagcgccgtggctacaaaaatgtgtttaacgccctgattcgaatcacccgggaagagggtgtcctcacactgtggcggggctgcatccctaccatggctcgggccgtcgtcgtcaatgctgcccagctcgcctcctactcccaatccaagcagttcttactggactcaggctacttctctgacaacatcttgtgccacttctgtgccagcatgatcagcggtcttgtcaccactgctgcctccatgcctgtggacattgccaagacccgaatccagaacatgcggatgattgatgggaagccggaatacaagaacgggctggacgtgctgttcaaagttgtccgctacgagggcttcttcagcctgtggaagggcttcacgccgtactatgcccgcctgggcccccacaccgtcctcaccttcatcttcttggagcagatgaacaaggcctacaagcgtctcttcctcagtggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha - fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus) - phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta |