Cart 54 Product Products 7 584,35 € (empty)
-
1 x NANP-N-ace...113,40 € -
-
1 x RAB40B-RAB...121,50 € -
1 x VPS37D-vac...113,40 € -
1 x FADS1-fatt...121,50 € -
-
1 x CDX4-cauda...121,50 € -
1 x PCNXL2-pec...121,50 € -
1 x RNF175-rin...121,50 € -
1 x CRELD2-cys...121,50 € -
1 x POLR3D-pol...121,50 € -
-
1 x ALOX5AP-ar...113,40 € -
1 x AKR7A3-ald...121,50 € -
1 x ZNF223-zin...121,50 € -
1 x KRT17-kera...121,50 € -
1 x COX19-COX1...113,40 € -
-
1 x Claudin-8...259,07 € -
-
1 x PECI-perox...121,50 € -
1 x TNIP3-TNFA...121,50 € -
1 x MEK...259,07 € -
1 x DUSP18-dua...113,40 € -
1 x KCNG4-pota...113,40 € -
1 x CDKN2AIPNL...113,40 € -
-
1 x SDCBP2-syn...121,50 € -
1 x MRPL4-mito...121,50 € -
1 x Goat...225,00 € -
-
1 x CCL16-chem...113,40 € -
1 x NT5C1A-5'-...121,50 € -
-
1 x ELOVL7-ELO...121,50 € -
1 x TOLLIP-tol...121,50 € -
1 x Mucin 1...259,07 € -
1 x MYPT1...259,07 € -
1 x TMED4-tran...113,40 € -
1 x LOC285398-...113,40 € -
1 x CASC4-canc...121,50 € -
-
-
-
1 x Olfactory...259,07 € -
-
1 x DNAL4-dyne...113,40 € -
1 x MPZL2-myel...113,40 € -
1 x RRP1-ribos...121,50 € -
1 x HS3ST1-hep...121,50 € -
1 x TMPRSS6-tr...121,50 € -
1 x UBXN11-UBX...121,50 € -
-
1 x OR2A4-olfa...121,50 €
No products
To be determined Shipping
7 584,35 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 54 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 584,35 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 584,35 €
Data sheet of FLJ11151-hypothetical protein FLJ11151 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FLJ11151-hypothetical protein FLJ11151 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006289 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FLJ11151 |
| Origin species: | Human |
| Product name: | FLJ11151-hypothetical protein FLJ11151 Gene |
| Size: | 2ug |
| Accessions: | BC006289 |
| Gene id: | 55313 |
| Gene description: | hypothetical protein FLJ11151 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggctgcagaggcggggggtgttttccacagagccaggggcaggaccctggacgcgtttcccgcagaaaaggaaagcgaatggaaaggcccattctacttcatcctgggcgcagacccacagtttgggctgatcaaggcctggtccactggggactgtgacaatggcggtgacgaatgggaacaggagatccgtctaactgagcaagccgtccaggccatcaacaagctgaaccccaaacccaaattcttcgttctgtgcggcgacctcatccacgccatgccagggaagccgtggcggacggagcagacggaggacctgaagcgagtgcttagggcagtggacagggccatcccactggtccttgtcagcggcaaccatgacattggcaacacccccacggccgagaccgtcgaggagttctgccggacttggggagatgactacttcagcttctgggtcgggggcgtcctgttcctggtcctcaactcccagttctacgagaacccctccaaatgccccagcctgaagcaggctcaggaccagtggctggacgagcagctgagcatcgcgaggcagcggcactgccagcatgccatcgtcttccagcacatcccgctgttcctggagagcatcgacgaggacgacgactactacttcaacctcagcaagtccactcggaagaagttggcagacaagttcatccacgcaggtgtcagagtcgtgttctcaggccactaccacaggaatgccgggggtacctaccagaacctcgacatggtggtgtcatctgccattggatgccagctgggcagagacccccacgggctccgagtcgtggtggtcaccgccgagaaaattgttcaccgatactacagtctagatgagctgagtgagaaaggaatagaagacgatctcatggatttgatcaagaaaaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peroxisomal biogenesis factor 16 - casein kinase 1, alpha 1-like - dual specificity phosphatase 12 - guanosine monophosphate reductase |