Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SCYE1-small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) Gene
PTXBC014051
New product
Data sheet of SCYE1-small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCYE1-small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014051 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCYE1 |
| Origin species: | Human |
| Product name: | SCYE1-small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) Gene |
| Size: | 2ug |
| Accessions: | BC014051 |
| Gene id: | 9255 |
| Gene description: | small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating) |
| Synonyms: | SCYE1; EMAP2; EMAPII; HLD3; p43; aminoacyl tRNA synthase complex-interacting multifunctional protein 1; ARS-interacting multifunctional protein 1; endothelial monocyte-activating polypeptide 2; endothelial-monocyte activating polypeptide II; multisynthase complex auxiliary component p43; multisynthetase complex auxiliary component p43; small inducible cytokine subfamily E, member 1 (endothelial monocyte-activating); aminoacyl tRNA synthetase complex interacting multifunctional protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaaataatgatgctgttctgaagagactggagcagaagggtgcagaggcagatcaaatcattgaatatcttaagcagcaagtttctctacttaaggagaaagcaattttgcaggcaactttgagggaagagaagaaacttcgagttgaaaatgctaaactgaagaaagaaattgaagaactgaaacaagagctaattcaggcagaaattcaaaatggagtgaagcaaataccatttccatctggtactccactgcacgctaattctatggtttctgaaaatgtgatacagtctacagcagtaacaaccgtatcttctggtaccaaagaacagataaaaggaggaacaggagacgaaaagaaagcgaaagagaaaattgaaaagaaaggagagaagaaggagaaaaaacagcaatcaatagctggaagtgccgactctaagccaatagatgtttcccgtctggatcttcgaattggttgcatcataactgctagaaaacaccctgatgcagattctttgtatgtggaagaagtagatgtcggagaaatagccccaaggacagttgtcagtggcctggtgaatcatgttcctcttgaacagatgcaaaatcggatggtgattttactttgtaacctgaaacctgcaaagatgaggggagtattatctcaagcaatggtcatgtgtgctagttcaccagagaaaattgaaatcttggctcctccaaatgggtctgttcctggagacagaattacttttgatgctttcccaggagagcctgacaaggagctgaatcctaagaagaagatttgggagcagatccagcctgatcttcacactaatgatgagtgtgtggctacatacaaaggagttccctttgaggtgaaagggaagggagtatgtagggctcaaaccatgagcaacagtggaatcaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 7, (neutral amino acid transporter, y+ system) member 10 - myxovirus (influenza virus) resistance 1, interferon-inducible protein p78 (mouse) - guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type - sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) |