Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CLN6-ceroid-lipofuscinosis, neuronal 6, late infantile, variant Gene
PTXBC010849
New product
Data sheet of CLN6-ceroid-lipofuscinosis, neuronal 6, late infantile, variant Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CLN6-ceroid-lipofuscinosis, neuronal 6, late infantile, variant Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010849 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CLN6 |
| Origin species: | Human |
| Product name: | CLN6-ceroid-lipofuscinosis, neuronal 6, late infantile, variant Gene |
| Size: | 2ug |
| Accessions: | BC010849 |
| Gene id: | 54982 |
| Gene description: | ceroid-lipofuscinosis, neuronal 6, late infantile, variant |
| Synonyms: | CLN4A; HsT18960; nclf; ceroid-lipofuscinosis neuronal protein 6; ceroid-lipofuscinosis neuronal 6 late infantile; ceroid-lipofuscinosis, neuronal 6, late infantile, variant |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggcgacgcggaggcggcagcacctgggagcgacgggcggcccaggcgcgcagctgggcgcctccttcctgcaggccaggcatggctctgtgagcgctgatgaggctgcccgcacggctcccttccacctcgacctctggttctacttcacactgcagaactgggttctggactttgggcgtcccattgccatgctggtattccctctcgagtggtttccactcaacaagcccagtgttggggactacttccacatggcctacaacgtcatcacgccctttctcttgctcaagctcatcgagcggtccccccgcaccctgccacgctccatcacgtacgtgagcatcatcatcttcatcatgggtgccagcatccacctggtgggtgactctgtcaaccaccgcctgctcttcagtggctaccagcaccacctgtctgtccgtgagaaccccatcatcaagaatctcaagccggagacgctgatcgactcctttgagctgctctactattatgatgagtacctgggtcactgcatgtggtacatccccttcttcctcatcctcttcatgtacttcagcggctgctttactgcctctaaagctgagagcttgattccagggcctgccctgctcctggtggcacccagtggcctgtactactggtacctggtcaccgagggccagatcttcatcctcttcatcttcaccttcttcgccatgctggccctcgtcctgcaccagaagcgcaagcgcctcttcctggacagcaacggcctcttcctcttctcctccttcgcactgaccctcttgcttgtggcgctctgggtcgcctggctgtggaatgaccctgttctcaggaagaagtacccgggtgtcatctacgtccctgagccctgggctttctacacccttcacgtcagcagtcggcactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 39 (zinc transporter), member 13 - carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 4 - brain and reproductive organ-expressed (TNFRSF1A modulator) - polymerase (RNA) III (DNA directed) polypeptide D, 44kDa |