Cart 44 Product Products 5 049,87 € (empty)
-
1 x ECHS1-enoy...121,50 € -
1 x TAF5L-TAF5...121,50 € -
1 x SPAG7-sper...113,40 € -
-
1 x LMBR1L-lim...121,50 € -
1 x FDX1L-ferr...113,40 € -
-
-
1 x FAM124B-fa...121,50 € -
1 x PITX1-pair...121,50 € -
1 x ACTL6A-act...121,50 € -
1 x CD200-CD20...121,50 € -
1 x IGFBP5-ins...121,50 € -
1 x FAM27L-fam...113,40 € -
1 x CACNG3-cal...121,50 € -
1 x MIOX-myo-i...121,50 € -
1 x MRPL45-mit...121,50 € -
1 x F7-coagula...121,50 € -
-
1 x NDUFV3-NAD...113,40 € -
1 x EDNRA-endo...121,50 € -
1 x FLI1-Frien...121,50 € -
1 x SCAMP1-sec...113,40 € -
1 x LOC1001255...113,40 € -
-
-
-
-
1 x C3orf45-ch...113,40 € -
1 x C20orf141-...113,40 € -
1 x ATP6V0C-AT...113,40 € -
1 x C7orf53-ch...113,40 € -
-
1 x CCDC28A-co...113,40 € -
1 x LGALS8-lec...121,50 € -
1 x DRG1-devel...121,50 € -
1 x SGMS1-sphi...121,50 € -
-
1 x CDH19-cadh...121,50 € -
1 x INPP5K-ino...121,50 € -
1 x EDN1-endot...113,40 € -
-
1 x NFIB-nucle...121,50 € -
1 x WDR41-WD...121,50 €
No products
To be determined Shipping
5 049,87 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 44 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 049,87 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 049,87 €
View larger 
UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene
PTXBC015116
New product
Data sheet of UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015116 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UPRT |
| Origin species: | Human |
| Product name: | UPRT-uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC015116 |
| Gene id: | 139596 |
| Gene description: | uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) |
| Synonyms: | FUR1; UPP; uracil phosphoribosyltransferase homolog; RP11-311P8.3; UMP pyrophosphorylase; UPRTase; uracil phosphoribosyltransferase (FUR1) homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccacggagttacagtgtccggactccatgccctgtcacaaccagcaagtaaactctgcctcaaccccaagtcccgagcagctgcgacctggcgatctgatcctggaccacgcagggggaaacagagcctccagggccaaggtgattctcctcacggggtacgcccattctagcctgccggccgagctggactctggggcctgcggcggctccagcctcaactcagagggcaacagtggtagtggtgacagtagcagctatgacgcaccagctggcaactccttcctagaggactgcgaactctcccggcagatcggggcgcagcttaagctgctgcctatgaatgatcagatacgggagctacagaccatcatccgggacaagacagccagtagaggtgacttcatgttttctgcggatcgtttgatcagacttgttgtggaagagggattgaatcagctgccatataaagaatgcatggtgaccactccaacagggtacaagtatgaaggagtgaaatttgagaagggaaattgtggggtcagcataatgagaagcggtgaggcaatggaacaaggtttacgagactgctgtcgatccatacgaattggaaagatcctgattcagagtgatgaggagacacaaagagccaaagtatattatgccaaattccccccagacatttaccggagaaaagtccttctgatgtatccaattctcagcactggaaatactgtaattgaagctgtaaaggttcttatagaacatggagttcaacccagtgttatcatcctactcagtctgttctccactcctcatggtgccaaatcaatcattcaggagtttccagagatcacaattttaactactgaagttcatcctgttgcacctacacattttggacagaaatactttggaacagactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25 (mitochondrial carrier), member 18 - tumor necrosis factor, alpha-induced protein 1 (endothelial) - solute carrier family 29 (nucleoside transporters), member 2 - UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5 |