Cart 51 Product Products 6 508,00 € (empty)
-
1 x C9orf78-ch...121,50 € -
1 x MTAP-methy...121,50 € -
1 x C9orf37-ch...113,40 € -
-
1 x KRR1-KRR1,...121,50 € -
1 x NUDT6-nudi...121,50 € -
1 x TMEM14A-tr...113,40 € -
1 x PLCXD1-pho...121,50 € -
1 x FBXW2-F-bo...121,50 € -
1 x CCDC106-co...121,50 € -
1 x ZNRF1-zinc...113,40 € -
1 x C12orf49-c...113,40 € -
1 x DMRTC2-DMR...121,50 € -
-
-
1 x CC2D1B-coi...113,40 € -
1 x CHMP4B-chr...113,40 € -
1 x ATP6V1E2-A...113,40 € -
1 x C12orf57-c...113,40 € -
1 x NSBP1-nucl...121,50 € -
1 x C5orf35-ch...121,50 € -
1 x SFT2D2-SFT...113,40 € -
1 x GLOD4-glyo...121,50 € -
1 x AXIN2-axin...113,40 € -
1 x LZTFL1-leu...121,50 € -
-
1 x GPN3-GPN-l...121,50 € -
1 x CKM-creati...121,50 € -
1 x FLJ40125-h...113,40 € -
1 x C4orf7-chr...113,40 € -
1 x S100A7-S10...113,40 € -
1 x HSFY1-heat...121,50 € -
1 x FHAD1-fork...113,40 € -
1 x ISX-intest...113,40 € -
1 x Olfactory...259,07 € -
1 x PPP1R1B-pr...113,40 € -
1 x GOLPH3L-go...121,50 € -
1 x C11orf51-c...113,40 € -
-
1 x CALCOCO2-c...121,50 € -
1 x C5orf13-ch...113,40 € -
1 x TXNL1-thio...121,50 € -
1 x STMN4-stat...113,40 € -
1 x GTPBP5...259,07 € -
1 x RANGRF-RAN...113,40 € -
1 x EIF2C3-euk...113,40 € -
1 x RABGGTB-Ra...121,50 € -
-
-
1 x ATP6V1C2-A...121,50 € -
1 x Prolactin459,00 €
No products
To be determined Shipping
6 508,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 51 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 508,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 508,00 €
Data sheet of GPR162-G protein-coupled receptor 162 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPR162-G protein-coupled receptor 162 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002353 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPR162 |
| Origin species: | Human |
| Product name: | GPR162-G protein-coupled receptor 162 Gene |
| Size: | 2ug |
| Accessions: | BC002353 |
| Gene id: | 27239 |
| Gene description: | G protein-coupled receptor 162 |
| Synonyms: | GRCA; gene rich cluster, A; gene-rich cluster gene A protein; G protein-coupled receptor 162 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctgagcactggggtggtgagcttcttctccctcaagtcggactcggcgcccccctggatggtgctggctgtgctgtggtgctccatggcacagacgctgctgctgccctccttcatctggtcctgcgagcgctaccgcgccgacgtgcgcacagtgtgggagcaatgcgtggccatcatgtctgaggaggatggagatgacgatgggggctgtgacgactatgcagagggccgagtttgcaaagttcgctttgatgctaacggagccacaggaccagggagccgggaccccgcccaggtgaagctgctgcctggaaggcacatgctcttccctcctcttgagagagtccactacttacaggtccccctatcccggcgtctgtcccatgatgagacaaacatcttctctacccctcgggaaccaggctccttcctgcacaagtggtcatcctctgatgacatccgggtcctcccagcccagagccgggccctcgggggtcctcctgagtacctgggacaaagacacaggttggaggacgaggaggacgaggaagaggctgaaggtggggggctggccagccttcgccaattcttggagagtggggttctggggtcaggtgggggacccccacggggtcctggcttcttccgggaggagatcaccaccttcatcgatgagacacctctgccttctccgactgcctcaccagggcactctcctcgtcggccccggccactgggcctctcaccccgccgactctcccttgggtcccctgagagcagagccgttggacttcctttgggactaagcgcagggagacgctgctccctgacggggggtgaagaaagtgcaagggcttggggaggatcctggggcccaggcaaccccatctttccccagctgaccctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - palmitoyl-protein thioesterase 1 - TSC22 domain family, member 4 - NMDA receptor regulated 1-like - melanoma antigen family A, 12 |