Cart 3 Product Products 328,22 € (empty)
-
-
-
1 x CRK-v-crk...113,40 €
No products
To be determined Shipping
328,22 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 328,22 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 328,22 €
Data sheet of HOXC11-homeobox C11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HOXC11-homeobox C11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001543 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HOXC11 |
| Origin species: | Human |
| Product name: | HOXC11-homeobox C11 Gene |
| Size: | 2ug |
| Accessions: | BC001543 |
| Gene id: | 3227 |
| Gene description: | homeobox C11 |
| Synonyms: | HOX3H; homeobox protein Hox-C11; homeo box C11; homeobox protein Hox-3H; homeobox C11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtttaactcggtcaacctgggcaacttctgctcgccgtcgcgcaaggagaggggcgcagatttcggcgagcgagggagctgcgcctccaacctctatctgcccagttgcacttactacatgcccgagttctccacggtcttctccttcctgccccaggccccctctcgtcagatctcctatccctactcggcccaagtgcccccggtccgggaggtctcctacggcctggagccatccggcaagtggcaccatcggaacagctactcctcctgctatgcggcggccgacgagcttatgcaccgggagtgcctgcctccttccaccgtcaccgagatcctcatgaaaaacgaaggctcctacggcggccaccaccaccccagcgccccgcacgcaacccccgccggcttctactcctcagtcaacaagaacagcgtcctgcctcaagccttcgaccgtttcttcgacaacgcctactgcggtggcggcgacccgcccgccgagcccccctgctccggcaagggcgaggccaagggggagcccgaggcacccccggcctcgggactggcgtcccgggctgaggcgggtgccgaggcggaggctgaggaggagaacacaaatcccagctcgtccggttcagcccactccgtggccaaggagccggccaaaggagccgcccccaacgccccccgcacccgcaagaagcgctgcccttattcgaaattccagatccgggaactggagcgagagtttttcttcaacgtgtatatcaacaaagagaagcggctgcagctgtcccggatgctgaacctgacggaccgacaagtgaaaatttggtttcagaacagaaggatgaaagaaaagaaactgagcagagaccggctgcagtatttctcgggaaatcctctgctgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pim-2 oncogene - crystallin, mu - homeobox C10 - THO complex 3 |