Cart 16 Product Products 2 004,37 € (empty)
-
1 x RP4-662A9....113,40 € -
1 x WDR21A-WD...121,50 € -
1 x PELI3-pell...121,50 € -
1 x POU2AF1-PO...113,40 € -
-
1 x IL11RA-int...121,50 € -
1 x GUCA1A-gua...113,40 € -
1 x BDH1-3-hyd...121,50 € -
1 x IGKV1-5-im...113,40 € -
1 x EMID2-EMI...121,50 € -
1 x IFIT5-inte...121,50 € -
1 x ZNF587-zin...113,40 € -
1 x SH3BP5L-SH...121,50 € -
1 x WFDC5-WAP...113,40 € -
1 x SLC12A7-so...121,50 € -
1 x TPM1-tropo...121,50 €
No products
To be determined Shipping
2 004,37 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 16 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 004,37 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 004,37 €
Data sheet of UNG-uracil-DNA glycosylase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UNG-uracil-DNA glycosylase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015205 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UNG |
| Origin species: | Human |
| Product name: | UNG-uracil-DNA glycosylase Gene |
| Size: | 2ug |
| Accessions: | BC015205 |
| Gene id: | 7374 |
| Gene description: | uracil-DNA glycosylase |
| Synonyms: | DGU; HIGM4; HIGM5; UDG; UNG1; UNG15; UNG2; uracil-DNA glycosylase; uracil-DNA glycosylase 1, uracil-DNA glycosylase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgtcttctgccttgggccgtgggggttgggccggaagctgcggacgcctgggaaggggccgctgcagctcttgagccgcctctgcggggaccacttgcaggccatcccagccaagaaggccccggctgggcaggaggagcctgggacgccgccctcctcgccgctgagtgccgagcagttggaccggatccagaggaacaaggccgcggccctgctcagactcgcggcccgcaacgtgcccgtgggctttggagagagctggaagaagcacctcagcggggagttcgggaaaccgtattttatcaagctaatgggatttgttgcagaagaaagaaagcattacactgtttatccacccccacaccaagtcttcacctggacccagatgtgtgacataaaagatgtgaaggttgtcatcctgggacaggatccatatcatggacctaatcaagctcacgggctctgctttagtgttcaaaggcctgttccgcctccgcccagtttggagaacatttataaagagttgtctacagacatagaggattttgttcatcctggccatggagatttatctgggtgggccaagcaaggtgttctccttctcaacgctgtcctcacggttcgtgcccatcaagccaactctcataaggagcgaggctgggagcagttcactgatgcagttgtgtcctggctaaatcagaactcgaatggccttgttttcttgctctggggctcttatgctcagaagaagggcagtgccattgataggaagcggcaccatgtactacagacggctcatccctcccctttgtcagtgtatagagggttctttggatgtagacacttttcaaagaccaatgagctgctgcagaagtctggcaagaagcccattgactggaaggagctgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carbonic anhydrase XI - centromere protein N - NDRG family member 4 - DMRT-like family C2 |