Cart 1 Product Products 113,40 € (empty)
-
1 x NDUFS3-NAD...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
Data sheet of STUB1-STIP1 homology and U-box containing protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about STUB1-STIP1 homology and U-box containing protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007545 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | STUB1 |
| Origin species: | Human |
| Product name: | STUB1-STIP1 homology and U-box containing protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC007545 |
| Gene id: | 10273 |
| Gene description: | STIP1 homology and U-box containing protein 1 |
| Synonyms: | HSPABP2; NY-CO-7; SCAR16; SDCCAG7; UBOX1; E3 ubiquitin-protein ligase CHIP; CLL-associated antigen KW-8; STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase; antigen NY-CO-7; carboxy terminus of Hsp70-interacting protein; heat shock protein A binding protein 2 (c-terminal); serologically defined colon cancer antigen 7; STIP1 homology and U-box containing protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagggcaaggaggagaaggagggcggcgcacggctgggcgctggcggcggaagccccgagaagagcccgagcgcgcaggagctcaaggagcagggcaatcgtctgttcgtgggccgaaagtacccggaggcggcggcctgctacggccgcgcgatcacccggaacccgctggtggccgtgtattacaccaaccgggccttgtgctacctgaagatgcagcagcacgagcaggccctggccgactgccggcgcgccctggagctggacgggcagtctgtgaaggcgcacttcttcctggggcagtgccagctggagatggagagctatgatgaggccatcgccaatctgcagcgagcttacagcctggccaaggagcagcggctgaacttcggggacgacatccccagcgctcttcgaatcgcgaagaagaagcgctggaacagcattgaggagcggcgcatccaccaggagagcgagctgcactcctacctctccaggctcattgccgcggagcgtgagagggagctggaagagtgccagcgaaaccacgagggtgatgaggacgacagccacgtccgggcccagcaggcctgcattgaggccaagcacgacaagtacatggcggacatggacgagcttttttctcaggtggatgagaagaggaagaagcgagacatccccgactacctgtgtggcaagatcagctttgagctgatgcgggagccgtgcatcacgcccagtggcatcacctacgaccgcaaggacatcgaggagcacctgcagcgtgtgggtcattttgaccccgtgacccggagccccctgacccaggaacagctcatccccaacttggctatgaaggaggttattgacgcattcatctctgagaatggctgggtggaggactactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 82, member B - non-SMC element 4 homolog A (S. cerevisiae) - family with sequence similarity 50, member B - LIM and senescent cell antigen-like domains 1 |