Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NMNAT2-nicotinamide nucleotide adenylyltransferase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NMNAT2-nicotinamide nucleotide adenylyltransferase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020998 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NMNAT2 |
| Origin species: | Human |
| Product name: | NMNAT2-nicotinamide nucleotide adenylyltransferase 2 Gene |
| Size: | 2ug |
| Accessions: | BC020998 |
| Gene id: | 23057 |
| Gene description: | nicotinamide nucleotide adenylyltransferase 2 |
| Synonyms: | C1orf15; PNAT2; nicotinamide/nicotinic acid mononucleotide adenylyltransferase 2; NMN adenylyltransferase 2; NMN/NaMN adenylyltransferase 2; NaMN adenylyltransferase 2; nicotinamide mononucleotide adenylyltransferase 2; nicotinate-nucleotide adenylyltransferase 2; pyridine nucleotide adenylyltransferase 2; nicotinamide nucleotide adenylyltransferase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaaatccaggaactagaggaaattcaggcctgccaggggctctgggaagtgtttgttactctctcagaaagagccagggattatctgcacaaaactggaaggtttattgtgattggcgggattgtctcccctgtccacgactcctatggaaaacagggcctcgtgtcaagccggcaccgtctcatcatgtgtcagctggccgtccagaattctgattggatcagggtggacccttgggagtgctaccaggacacctggcagacgacctgcagcgtgttggaacaccaccgggacctcatgaagagggtgactggctgcatcctctccaatgtcaacacaccttccatgacacctgtgatcggacagccacaaaacgagaccccccagcccatttaccagaacagcaacgtggccaccaagcccactgcagccaagatcttggggaaggtgggagaaagcctcagccggatctgctgtgtccgcccgccggtggagcgtttcacctttgtagatgagaatgccaatctgggcacggtgatgcggtatgaagagattgagctacggatcctgctgctgtgtggtagtgacctgctggagtccttctgcatcccagggctctggaacgaggcagatatggaggtgattgttggtgactttgggattgtggtggtgccccgggatgcagccgacacagaccgaatcatgaatcactcctcaatactccgcaaatacaaaaacaacatcatggtggtgaaggatgacatcaaccatcccatgtctgttgtcagctcaaccaagagcaggctggccctgcagcatggggacggccatgttgtggattacctgtcccagccggtcatcgactacatcctcaaaagccagctgtacatcaatgcctccggctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NIMA (never in mitosis gene a)-related kinase 6 - tumor-associated calcium signal transducer 1 - tumor-associated calcium signal transducer 2 - interferon (alpha, beta and omega) receptor 2 |