Cart 1 Product Products 113,40 € (empty)
-
1 x NDUFS3-NAD...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
SLC25A15-solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 15 Gene
PTXBC002702
New product
Data sheet of SLC25A15-solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 15 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A15-solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 15 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002702 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A15 |
| Origin species: | Human |
| Product name: | SLC25A15-solute carrier family 25 (mitochondrial carrier, ornithine transporter) member 15 Gene |
| Size: | 2ug |
| Accessions: | BC002702 |
| Gene id: | 10166 |
| Gene description: | solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15 |
| Synonyms: | D13S327; HHH; ORC1; ORNT1; mitochondrial ornithine transporter 1; ornithine transporter 1; solute carrier family 25 (mitochondrial carrier; ornithine transporter) member 15; solute carrier family 25 member 15 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaatccaatcctgctatccaggctgccattgacctcacagcgggggctgcaggaggtacagcatgtgtactgaccgggcagccctttgacacaatgaaagtgaagatgcagacgttccctgacctgtaccggggcctcaccgactgctgcctgaagacttactcccaggtgggcttccgtggcttctacaagggtaccagtccagcactaatcgccaacatcgctgagaactcagtcctcttcatgtgctacggcttctgccagcaggtggtgcggaaagtggctggattggacaagcaggcaaagctgagtgatctgcagaatgcagccgccggttccttcgcctctgcctttgctgcactggtgctctgccccacggagctcgtgaagtgccggctgcagaccatgtatgagatggagacatcagggaagatagccaagagccagaatacagtgtggtctgtcatcaaaagtattcttaggaaagatggccccttggggttctaccatggactctcaagcactttacttcgagaagtaccaggctatttcttcttcttcggtggctatgaactgagccggtccttttttgcatcagggagatcaaaagatgaattaggccctgtacctttgatgttaagtggtggagttggtgggatttgcctctggcttgcggtatacccagtggattgtatcaaatccagaattcaagttctttccatgtctggaaaacaggcaggatttatcagaacctttttaaatgttgtgaaaaatgaaggaataacggccttatattctggactgaaacctactatgattcgagcattccctgccaatggagcactctttttggcctacgaatatagcaggaagttgatgatgaaccagttggaagcatactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11 - nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha - fascin homolog 3, actin-bundling protein, testicular (Strongylocentrotus purpuratus) - phosphodiesterase 4D, cAMP-specific (phosphodiesterase E3 dunce homolog, Drosophila) |