Cart 11 Product Products 2 303,93 € (empty)
-
1 x TMEM69-tra...113,40 € -
1 x ATP1B3-ATP...121,50 € -
1 x ATF1-activ...121,50 € -
1 x ZC3H8-zinc...121,50 € -
-
1 x RBM8A-RNA...113,40 € -
-
1 x UTP23-UTP2...113,40 € -
1 x DUSP12-dua...121,50 € -
1 x RN-tre...259,07 € -
No products
To be determined Shipping
2 303,93 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 303,93 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 303,93 €
View larger 
SCO1-SCO cytochrome oxidase deficient homolog 1 (yeast) Gene
PTXBC015504
New product
Data sheet of SCO1-SCO cytochrome oxidase deficient homolog 1 (yeast) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCO1-SCO cytochrome oxidase deficient homolog 1 (yeast) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015504 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCO1 |
| Origin species: | Human |
| Product name: | SCO1-SCO cytochrome oxidase deficient homolog 1 (yeast) Gene |
| Size: | 2ug |
| Accessions: | BC015504 |
| Gene id: | 6341 |
| Gene description: | SCO cytochrome oxidase deficient homolog 1 (yeast) |
| Synonyms: | SCO1, cytochrome c oxidase assembly protein; protein SCO1 homolog, mitochondrial; SCOD1; SCO cytochrome oxidase deficient homolog 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgatgctggtcctagtacccggacgagttatgcggcctctgggtggccaactttggcgcttcttgcctcgcggactcgagttttggggcccagccgaggggactgcgagagtcttgctgaggcagttctgcgcgcggcaagcggaggcgtggcgtgcctcggggcgccctggctattgcctgggaacccggcccctcagcactgcgaggccgccacccccgtggtcgcagaagggccccggagactccacgcgcccctcgaagcccgggcctgtttcctggaagtctttagcaatcacatttgctattggaggagctttactggctggaatgaagcacgtcaagaaagaaaaggcagagaagttagagaaggaacggcagcgacacatcggcaagcctttacttgggggaccgttttccctcacaactcatactggggagcgtaaaactgacaaggactacttgggtcagtggttattgatttattttggcttcactcattgccctgatgtctgtccagaagaactagaaaagatgattcaagtcgtggatgaaatagatagcattacaactctgccagatctaactccacttttcatcagcattgacccagagagggacacaaaagaagccatcgcaaattatgtgaaagaattttctcccaaactggttggcttgactggcacgagagaagaggtcgatcaagtggccagagcatacagagtgtattacagccctggccccaaggacgaagatgaagactacatagtggatcacacaataataatgtacttgattggaccagatggtgagtttctagattattttggccagaacaagaggaagggagaaatagctgcttcaattgccacacacatgaggccatacagaaaaaagagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase - zinc finger protein 36, C3H type, homolog (mouse) - WW domain containing E3 ubiquitin protein ligase 2 - vacuolar protein sorting 26 homolog B (S. pombe) |