Cart 2 Product Products 226,80 € (empty)
-
1 x PRPF38B-PR...113,40 € -
1 x VCY-variab...113,40 €
No products
To be determined Shipping
226,80 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 226,80 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 226,80 €
Data sheet of TMEM59-transmembrane protein 59 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM59-transmembrane protein 59 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003106 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM59 |
| Origin species: | Human |
| Product name: | TMEM59-transmembrane protein 59 Gene |
| Size: | 2ug |
| Accessions: | BC003106 |
| Gene id: | 9528 |
| Gene description: | transmembrane protein 59 |
| Synonyms: | C1orf8; DCF1; HSPC001; PRO195; UNQ169; transmembrane protein 59; dendritic cell factor 1; liver membrane-bound protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccttggccggaggttcggggaccgcttcggctgaagcatttgactcggtcttgggtgatacggcgtcttgccaccgggcctgtcagttgacctaccccttgcacacctaccctaaggaagaggagttgtacgcatgtcagagaggttgcaggctgttttcaatttgtcagtttgtggatgatggaattgacttaaatcgaactaaattggaatgtgaatctgcatgtacagaagcatattcccaatctgatgagcaatatgcttgccatcttggttgccagaatcagctgccattcgctgaactgagacaagaacaacttatgtccctgatgccaaaaatgcacctactctttcctctaactctggtgaggtcattctggagtgacatgatggactccgcacagagcttcataacctcttcatggactttttatcttcaagccgatgacggaaaaatagttatattccagtctaagccagaaatccagtacgcaccacatttggagcaggagcctacaaatttgagagaatcatctctaagcaaaatgtcctatctgcaaatgagaaattcacaagcgcacaggaattttcttgaagatggagaaagtgatggctttttaagatgcctctctcttaactctgggtggattttaactacaactcttgtcctctcggtgatggtattgctttggatttgttgtgcaactgttgctacagctgtggagcagtatgttccctctgagaagctgagtatctatggtgacttggagtttatgaatgaacaaaagctaaacagatatccagcttcttctcttgtggttgttagatctaaaactgaagatcatgaagaagcagggcctctacctacaaaagtgaatcttgctcattctgaaatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - kelch-like 3 (Drosophila) - transmembrane protein 74 - N-myc (and STAT) interactor - Ras-related GTP binding A |